pMSCV-LTR-dCas9-VP64-BFP
(Plasmid #46912)

• Purpose: Human expression vector containing MSCV LTR promoter, dCas9 that is fused to 2x NLS, VP64 and tagBFP
• Depositing Labs: Stanley Qi, Jonathan Weissman
• Publication: Gilbert et al Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.

Backbone

• Vector backbone: MSCV-puro
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 6300
• Total vector size (bp): 11369
• Vector type: Mammalian Expression, Retroviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: dCas9-VP64-BFP fusion
• Species: H. sapiens (human)
• Insert Size (bp): 5055
• Promoter: LTR
• Tags / Fusion Proteins:
  • 3xNLS (C terminal on insert)
  • BFP (C terminal on insert)
  • VP64 domain (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CCCTTGAACCTCCTCGTTCGACC
• 3′ sequencing primer: GAGACGTGCTACTTCCATTTGTC

Gene/Insert 2

• Gene/Insert name: Puromycin resistance
• Insert Size (bp): 654
• Promoter: PGK

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: CGGGCGCCCGAAGGTCCTCCG

Resource Information

• Articles Citing this Plasmid:
  • 10 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Cas9 contains a N612K mutation that does not effect the function of the enzyme.