Skip to main content
Addgene

AAV-EF1a-BbChT
(Plasmid #45186)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45186 Standard format: Plasmid sent in bacteria as agar stab 1 $85
AAV9 45186-AAV9 Limited Stock Available, 4 units left
Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid.
$405

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-EF1a-WPRE
  • Total vector size (bp) 1700
  • Vector type
    Mammalian Expression, AAV ; adeno-associated viral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pAAV-Ef1a-Brainbow/mCherry/mTFP-WPRE
  • Species
    coral fluorescent proteins
  • Insert Size (bp)
    1700
  • Promoter human EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer gatcttggttcattctcaagcctcag
  • 3′ sequencing primer tagcgtaaaaggagcaacatagt
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    cloned by Kim Cohen and Dawen Cai
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Information for AAV9 (Catalog # 45186-AAV9) ( Back to top)

Purpose

Ready-to-use AAV9 particles produced from AAV-EF1a-BbChT (#45186). In addition to the viral particles, you will also receive purified AAV-EF1a-BbChT plasmid DNA.

Brainbow construct encoding mCherry and mTFP, both in reverse orientation between mutant Lox sites. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
  • Buffer PBS + 0.001% Poloxamer 188
  • Serotype AAV9
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry, mTFP, or none

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-EF1a-BbChT was a gift from Dawen Cai & Joshua Sanes (Addgene plasmid # 45186 ; http://n2t.net/addgene:45186 ; RRID:Addgene_45186) For viral preps, please replace (Addgene plasmid # 45186) in the above sentence with: (Addgene viral prep # 45186-AAV9)
  • For your References section:

    Improved tools for the Brainbow toolbox. Cai D, Cohen KB, Luo T, Lichtman JW, Sanes JR. Nat Methods. 2013 May 5;10(6):540-7. doi: 10.1038/nmeth.2450. Epub 2013 May 5. 10.1038/nmeth.2450 PubMed 23817127