Skip to main content
Addgene

pThy1-Brainbow3.2
(Plasmid #45179)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45179 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC18
  • Total vector size (bp) 6300
  • Vector type
    linearized for transgenic mouse injection

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pThy1-Brainbow3.2
  • Species
    jelly fish and coral fluorescent proteins
  • Insert Size (bp)
    6300
  • Promoter Thy1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site I-CeuI (not destroyed)
  • 3′ cloning site SpeI/NheI (not destroyed)
  • 5′ sequencing primer TCTGAGTGGCAAAGGACCTTAGG
  • 3′ sequencing primer GACTTGGGGAGGGAGTCAGCTGACC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    cloned by Kim Cohen and Dawen Cai
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There are minor differences between the reference sequence and Addgene's quality control sequence that may add/remove restriction enzyme sites. None of the changes have any effect on the plasmid functions.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pThy1-Brainbow3.2 was a gift from Joshua Sanes (Addgene plasmid # 45179 ; http://n2t.net/addgene:45179 ; RRID:Addgene_45179)
  • For your References section:

    Improved tools for the Brainbow toolbox. Cai D, Cohen KB, Luo T, Lichtman JW, Sanes JR. Nat Methods. 2013 May 5;10(6):540-7. doi: 10.1038/nmeth.2450. Epub 2013 May 5. 10.1038/nmeth.2450 PubMed 23817127