pET-Sangamo-HIS
(Plasmid #40787)

• Purpose: for e. coli expression, Golden Gate Compatible TALEN incorporated with C Terminal 6xHIS Tag, Codon Optimized FokI
• Depositing Lab: Gang Bao
• Publication: Bao Lab Golden Gate plasmids (unpublished)

Backbone

• Vector backbone: pET-28b
• Backbone manufacturer: EMD Biosciences
• Backbone size w/o insert (bp): 3890
• Total vector size (bp): 5838
• Modifications to backbone: Addition of TALEN with +63 C Terminus and FokI Endonuclease. Includes 6xHis tag on C terminal of insert
• Vector type: Bacterial Expression, TALEN
• Selectable markers: XGAL/IPTG

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: LB + Antibiotics
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Transcription Activator Like Effector Nuclease
• Alt name: TALEN
• Species: Xanthamonas oryzae
• Insert Size (bp): 1948
• Mutation: +63 C Terminus,Codon Optimized FokI Endonuclease
• Promoter: T7
• Tag / Fusion Protein:
  • C Terminal 6xHIS

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (not destroyed)
• 3′ cloning site: BsmBI (not destroyed)
• 5′ sequencing primer: GTAACAGCGGTAGAGGCAGTG
• 3′ sequencing primer: CGTCCACCAAGACATGCCAAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please acknowledge the principal investigator, Dr. Gang Bao, and include this article in your citations if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 40787" in your Materials and Methods section.