Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TBRE-TK-Luc-MUT
(Plasmid #36245)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 36245 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTK-luc
  • Backbone size w/o insert (bp) 6800
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Two copies of the Brachyury T-box site
  • Mutation
    Mutations in the Brachyury palindromic element:CAC-->GGG and GTG-->CCC
  • Promoter TK minimal promoter
  • Tag / Fusion Protein
    • Luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer n/a
  • 3′ sequencing primer Luc_N_Rev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mutated Brachyury palindromic element:
AATTTGGGACCTAGGTCCCAAATT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TBRE-TK-Luc-MUT was a gift from Bruce Blumberg (Addgene plasmid # 36245 ; http://n2t.net/addgene:36245 ; RRID:Addgene_36245)
  • For your References section:

    RIPPLY3 is a retinoic acid-inducible repressor required for setting the borders of the pre-placodal ectoderm. Janesick A, Shiotsugu J, Taketani M, Blumberg B. Development. 2012 Mar;139(6):1213-24. 10.1242/dev.071456 PubMed 22354841