-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32497 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.1
-
Backbone manufacturerSabatini Lab
- Backbone size w/o insert (bp) 7000
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGSK3B
-
gRNA/shRNA sequence(AAA)GCTAGATCACTGTAACA
-
SpeciesH. sapiens (human)
-
Entrez GeneGSK3B
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site None (unknown if destroyed)
- 3′ cloning site None (unknown if destroyed)
- 5′ sequencing primer LKO.1 (GACTATCATATGCTTACCGT)
- 3′ sequencing primer none (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-GSK3β-#2 was a gift from Alex Toker (Addgene plasmid # 32497 ; http://n2t.net/addgene:32497 ; RRID:Addgene_32497) -
For your References section:
Akt/protein kinase b and glycogen synthase kinase-3beta signaling pathway regulates cell migration through the NFAT1 transcription factor. Yoeli-Lerner M, Chin YR, Hansen CK, Toker A. Mol Cancer Res. 2009 Mar;7(3):425-32. Epub 2009 Mar 3. 10.1158/1541-7786.MCR-08-0342 PubMed 19258413