Skip to main content
Addgene

pKP332 (Lenti-OSK1)
(Plasmid #21627)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21627 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pDL171 (pWPI with deletion of 1409 bp XhoI [EMCV IRES GFP] frag)
  • Backbone size w/o insert (bp) 9692
  • Vector type
    Mammalian Expression, Lentiviral, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hOCT4 - 2A - hSOX2 - 2A - hKLF4
  • Alt name
    POU5F1
  • Alt name
    Porcine teschovirus-1 2A peptide
  • Species
    H. sapiens (human); Porcine teschovirus-1
  • Insert Size (bp)
    3589
  • GenBank ID
    BC117435 BC029923 BC013923
  • Entrez Gene
    POU5F1 (a.k.a. OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)
  • Entrez Gene
    SOX2 (a.k.a. ANOP3, MCOPS3)
  • Entrez Gene
    KLF4 (a.k.a. EZF, GKLF)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SwaI (not destroyed)
  • 3′ cloning site SwaI (not destroyed)
  • 5′ sequencing primer GGCACCTCGATTAGTTCTCGAGC
  • 3′ sequencing primer AATCCAGAGGTTGATTATCG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid constructed by Kevin Pawlik

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKP332 (Lenti-OSK1) was a gift from Tim Townes (Addgene plasmid # 21627 ; http://n2t.net/addgene:21627 ; RRID:Addgene_21627)

  • For your References section:

    Polycistronic lentiviral vector for "hit and run" reprogramming of adult skin fibroblasts to induced pluripotent stem cells. Chang CW, Lai YS, Pawlik KM, Liu K, Sun CW, Li C, Schoeb TR, Townes TM. Stem Cells. 2009 May . 27(5):1042-9. 10.1002/stem.39 PubMed 19415770
Related items:
Commonly requested with: