pAAV-Syn-SomArchon-mTagBFP2-p2A-CoChR-Kv2.1
(Plasmid #206006)

• Purpose: Expression of SomArchon-mTagBFP2 and CoChR under Syn promoter
• Depositing Lab: Xue Han
• Publication: Lowet et al Cell Rep. 2023 Aug 29;42(8):112906. doi: 10.1016/j.celrep.2023.112906. Epub 2023 Aug 3.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV2-Syn
• Backbone size w/o insert (bp): 6337
• Total vector size (bp): 7517
• Modifications to backbone: N/A
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SomArchon-mTagBFP2-P2A-CoChR-Kv2.1
• Alt name: Soma-Optopatch-mTagBFP2
• Species: Synthetic
• Insert Size (bp): 1182
• GenBank ID: OR336299
• Promoter: hSyn
• Tag / Fusion Protein:
  • mTagBFP2 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: ggaaagaatcaaggaggcca
• 3′ sequencing primer: gtatccacatagcgtaaaaggagc

Resource Information

• Supplemental Documents:
  • pAAV-Syn-SomArchon-mTagBFP2-P2A-CoChR.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry