Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-Syn-SomArchon-mTagBFP2-p2A-CoChR-Kv2.1
(Plasmid #206006)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206006 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV2-Syn
  • Backbone size w/o insert (bp) 6337
  • Total vector size (bp) 7517
  • Modifications to backbone
    N/A
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SomArchon-mTagBFP2-P2A-CoChR-Kv2.1
  • Alt name
    Soma-Optopatch-mTagBFP2
  • Species
    Synthetic
  • Insert Size (bp)
    1182
  • GenBank ID
    OR336299
  • Promoter hSyn
  • Tag / Fusion Protein
    • mTagBFP2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer ggaaagaatcaaggaggcca
  • 3′ sequencing primer gtatccacatagcgtaaaaggagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Syn-SomArchon-mTagBFP2-p2A-CoChR-Kv2.1 was a gift from Xue Han (Addgene plasmid # 206006 ; http://n2t.net/addgene:206006 ; RRID:Addgene_206006)
  • For your References section:

    Theta and gamma rhythmic coding through two spike output modes in the hippocampus during spatial navigation. Lowet E, Sheehan DJ, Chialva U, De Oliveira Pena R, Mount RA, Xiao S, Zhou SL, Tseng HA, Gritton H, Shroff S, Kondabolu K, Cheung C, Wang Y, Piatkevich KD, Boyden ES, Mertz J, Hasselmo ME, Rotstein HG, Han X. Cell Rep. 2023 Aug 29;42(8):112906. doi: 10.1016/j.celrep.2023.112906. Epub 2023 Aug 3. 10.1016/j.celrep.2023.112906 PubMed 37540599