-
PurposeExpression of SomArchon-P2A-CoChR-Kv2.1 under Syn promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126945 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-Syn
- Backbone size w/o insert (bp) 5279
- Total vector size (bp) 7285
-
Modifications to backboneN/A
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSomArchon-P2A-CoChR-Kv2.1
-
Alt nameSoma-Optopatch
-
SpeciesSynthetic
-
Insert Size (bp)3006
- Promoter Synapsin
-
Tag
/ Fusion Protein
- GFP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcacgggcgcgaccatctgc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Syn-SomArchon-P2A-CoChR-Kv2.1 was a gift from Edward Boyden (Addgene plasmid # 126945 ; http://n2t.net/addgene:126945 ; RRID:Addgene_126945) -
For your References section:
Population imaging of neural activity in awake behaving mice. Piatkevich KD, Bensussen S, Tseng HA, Shroff SN, Lopez-Huerta VG, Park D, Jung EE, Shemesh OA, Straub C, Gritton HJ, Romano MF, Costa E, Sabatini BL, Fu Z, Boyden ES, Han X. Nature. 2019 Oct;574(7778):413-417. doi: 10.1038/s41586-019-1641-1. Epub 2019 Oct 9. 10.1038/s41586-019-1641-1 PubMed 31597963