FUW-OSKM
(Plasmid #20328)

• Purpose: Lentiviral plasmid expressing mouse Oct4, Sox2, Klf4 and cMyc for iPS cell generation
• Depositing Lab: Rudolf Jaenisch
• Publication: Carey et al Proc Natl Acad Sci U S A. 2009 Jan 6. 106(1):157-62.

Backbone

• Vector backbone: FUW (Lenti-Lox-Ubi)
• Backbone manufacturer: homemade
• Backbone size w/o insert (bp): 7222
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: TOP10, 37C
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Oct4-P2A-Sox2-T2A-Klf4-E2A-cMyc
• Species: M. musculus (mouse)
• Insert Size (bp): 5000
• Entrez Gene: Myc (a.k.a. Myc2, Niard, Nird, bHLHe39)
• Entrez Gene: Sox2 (a.k.a. Sox-2, lcc, ysb)
• Entrez Gene: Pou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)
• Entrez Gene: Klf4 (a.k.a. EZF, Gklf, Zie)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ACTTTGCAGCCTGAGGGCCA

Resource Information

• Articles Citing this Plasmid:
  • 17 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry