pET-Neq2X
(Plasmid #182365)

• Purpose: Expresses Neq2X DNA polymerase
• Depositing Lab: Morten Norholm
• Publication: Hernandez-Rollan et al BMC Biotechnol. 2024 Apr 2;24(1):17. doi: 10.1186/s12896-024-00844-7.

Backbone

• Vector backbone: pET
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 7999
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Neq2X
• Species: Nanoarchaeum equitans
• Insert Size (bp): 2430
• Promoter: T7
• Tag / Fusion Protein:
  • His-tag (N terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: atgcatcaccatcaccatcacggatcaatg
• 3′ sequencing primer: cacattcacaggcaaaaaactaacagatttctttaaa

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Ordered from GeneScript
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2022.03.14.484273v1 for bioRxiv preprint.