Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET-Neq2X
(Plasmid #182365)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182365 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 7999
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Neq2X
  • Species
    Nanoarchaeum equitans
  • Insert Size (bp)
    2430
  • Promoter T7
  • Tag / Fusion Protein
    • His-tag (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer atgcatcaccatcaccatcacggatcaatg
  • 3′ sequencing primer cacattcacaggcaaaaaactaacagatttctttaaa
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Ordered from GeneScript

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-Neq2X was a gift from Morten Norholm (Addgene plasmid # 182365 ; http://n2t.net/addgene:182365 ; RRID:Addgene_182365)
  • For your References section:

    Neq2X7: a multi-purpose and open-source fusion DNA polymerase for advanced DNA engineering and diagnostics PCR. Hernandez-Rollan C, Ehrmann AK, Vlassis A, Kandasamy V, Norholm MHH. BMC Biotechnol. 2024 Apr 2;24(1):17. doi: 10.1186/s12896-024-00844-7. 10.1186/s12896-024-00844-7 PubMed 38566117