Skip to main content
Addgene

pmirGLO:Δluc::gfp ΔAmpR::KanR
(Plasmid #176640)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176640 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pmirGLO
  • Backbone manufacturer
    Promega
  • Total vector size (bp) 4019
  • Modifications to backbone
    substituted luc2 CDS for emGFP CDS; substituted AmpR resistance gene for KanR resistance gene; deleted hRluc-neo with SV40 promoter
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    emGFP
  • Insert Size (bp)
    720
  • Promoter Human PGK-1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGGTGAGCAAGGGCGA
  • 3′ sequencing primer TTACTTGTACAGCTCGTCCATGC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmirGLO:Δluc::gfp ΔAmpR::KanR was a gift from Pardis Sabeti (Addgene plasmid # 176640 ; http://n2t.net/addgene:176640 ; RRID:Addgene_176640)

  • For your References section:

    Genome-wide functional screen of 3'UTR variants uncovers causal variants for human disease and evolution. Griesemer D, Xue JR, Reilly SK, Ulirsch JC, Kukreja K, Davis JR, Kanai M, Yang DK, Butts JC, Guney MH, Luban J, Montgomery SB, Finucane HK, Novina CD, Tewhey R, Sabeti PC. Cell. 2021 Sep 30;184(20):5247-5260.e19. doi: 10.1016/j.cell.2021.08.025. Epub 2021 Sep 16. 10.1016/j.cell.2021.08.025 PubMed 34534445
Related items:
Commonly requested with: