modified pcAT7-Glo1
(Plasmid
#160996)
-
PurposeSplicing reporter backbone
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160996 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6955
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehemoglobin subunit beta
-
Alt nameHBB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1600
-
MutationRepeated intron 1 with 40 nucelotide deletion
-
GenBank IDNM_000518
-
Entrez GeneHBB (a.k.a. CD113t-C, ECYT6, beta-globin)
- Promoter CAG
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe original version of this plasmid was received from Kristen Lynch at University of Pennsylvania. A 40 bp deletion in intron 1 was made in intron 1 compared to the original pcAT7-Glo1.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloning for initial Vex-seq inserts is between the PstI and XbaI sites. The second step for generating the final splicing reporter involves PCR amplifying intron 2 and exon 3 from modified pcAT7-Glo1 using GTGTGGAAGTCTCAGGATCG and AACGGGCCCTCTAGAGC and digesting with XbaI and MfeI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
modified pcAT7-Glo1 was a gift from Brenton Graveley (Addgene plasmid # 160996 ; http://n2t.net/addgene:160996 ; RRID:Addgene_160996) -
For your References section:
Vex-seq: high-throughput identification of the impact of genetic variation on pre-mRNA splicing efficiency. Adamson SI, Zhan L, Graveley BR. Genome Biol. 2018 Jun 1;19(1):71. doi: 10.1186/s13059-018-1437-x. 10.1186/s13059-018-1437-x PubMed 29859120