pmirGLO:Δluc::gfp ΔAmpR::KanR
(Plasmid
#176640)
-
PurposeMPRAu backbone vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176640 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepmirGLO
-
Backbone manufacturerPromega
- Total vector size (bp) 4019
-
Modifications to backbonesubstituted luc2 CDS for emGFP CDS; substituted AmpR resistance gene for KanR resistance gene; deleted hRluc-neo with SV40 promoter
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameemGFP
-
Insert Size (bp)720
- Promoter Human PGK-1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGTGAGCAAGGGCGA
- 3′ sequencing primer TTACTTGTACAGCTCGTCCATGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmirGLO:Δluc::gfp ΔAmpR::KanR was a gift from Pardis Sabeti (Addgene plasmid # 176640 ; http://n2t.net/addgene:176640 ; RRID:Addgene_176640) -
For your References section:
Genome-wide functional screen of 3'UTR variants uncovers causal variants for human disease and evolution. Griesemer D, Xue JR, Reilly SK, Ulirsch JC, Kukreja K, Davis JR, Kanai M, Yang DK, Butts JC, Guney MH, Luban J, Montgomery SB, Finucane HK, Novina CD, Tewhey R, Sabeti PC. Cell. 2021 Sep 30;184(20):5247-5260.e19. doi: 10.1016/j.cell.2021.08.025. Epub 2021 Sep 16. 10.1016/j.cell.2021.08.025 PubMed 34534445