pMPRAv3:minP-GFP
(Plasmid
#109036)
-
PurposeMPRA v3 minimal promoter with GFP donor
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 109036 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL4.23
-
Backbone manufacturerPromega
- Total vector size (bp) 3356
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameemGFP
-
Insert Size (bp)726
- Promoter minP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGTGAGCAAGGGCGA
- 3′ sequencing primer TTATCATTACTTGTACAGCTCGTCCATGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMPRAv3:minP-GFP was a gift from Pardis Sabeti & Ryan Tewhey (Addgene plasmid # 109036 ; http://n2t.net/addgene:109036 ; RRID:Addgene_109036) -
For your References section:
Direct Identification of Hundreds of Expression-Modulating Variants using a Multiplexed Reporter Assay. Tewhey R, Kotliar D, Park DS, Liu B, Winnicki S, Reilly SK, Andersen KG, Mikkelsen TS, Lander ES, Schaffner SF, Sabeti PC. Cell. 2016 Jun 2;165(6):1519-29. doi: 10.1016/j.cell.2016.04.027. 10.1016/j.cell.2016.04.027 PubMed 27259153