Skip to main content

mNeonGreen-Sec61β
(Plasmid #169031)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169031 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    mNeonGreen-C1
  • Backbone manufacturer
    Allele Biotechnology
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 4998
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sec61β
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    295
  • Entrez Gene
    SEC61B
  • Promoter CMV
  • Tag / Fusion Protein
    • mNeonGreen (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer GGAGCTCAAGCACTCCAAGA
  • 3′ sequencing primer CAAATGTGGTATGGCTGATT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains minor discrepancies in the linker region between Sec61B and mNeonGreen compared to the depositor's sequence. These differences do not affect the plasmid's functions.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mNeonGreen-Sec61β was a gift from Gia Voeltz (Addgene plasmid # 169031 ; http://n2t.net/addgene:169031 ; RRID:Addgene_169031)
  • For your References section:

    Reticulon-3 Promotes Endosome Maturation at ER Membrane Contact Sites. Wu H, Voeltz GK. Dev Cell. 2021 Jan 11;56(1):52-66.e7. doi: 10.1016/j.devcel.2020.12.014. 10.1016/j.devcel.2020.12.014 PubMed 33434526