Per2:iLuc
(Plasmid #160293)

• Purpose: target Per2 gene with a color-switching luciferase cassette in mouse genome and the transfection of the recombinant DNA will lead genomic recombination and make a knock-in allele in mouse ES cells.
• Depositing Lab: Joseph Takahashi
• Publication: Shan et al Neuron. 2020 Aug 4. pii: S0896-6273(20)30529-8. doi: 10.1016/j.neuron.2020.07.012.

Backbone

• Vector backbone: homemade
• Backbone manufacturer: homemade
• Backbone size w/o insert (bp): 12590
• Total vector size (bp): 5100
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Per2LUC
• Species: M. musculus (mouse)
• Insert Size (bp): 1250
• Promoter: no promotor

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: 5’ ACCTCAGAAGCCAAAGAGGAG
• 3′ sequencing primer: 3’ GGGTCCATGTGATTAGAAACC

Resource Information

• Supplemental Documents:
  • Per2_iLuc (1).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note Addgene NGS had a hard time assembling highly repetitive regions in this plasmid. There are several small deletions in the Per2 intron region. Depositor confirms plasmid is functional and recommends perform long, sanger sequencing with relay primers to confirm the exact sequence of this repetitive region.