Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTYF-PRSx8-AstR-p2A-GFP
(Plasmid #159632)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159632 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTYF
  • Backbone size w/o insert (bp) 7835
  • Total vector size (bp) 10386
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    AstR
  • Alt name
    Allatostatin receptor, AstR, AlstR,
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    1184
  • GenBank ID
    AF163775.1
  • Entrez Gene
    AstA-R1 (a.k.a. Dmel_CG2872, ASR, AST-R, AlstR, AstA R1, AstAR1, CG2872, D.AlstR1, DAR-1, DAR1, DGR, Dar-1, Dmel\CG2872, EG:121E7.2, GR)
  • Promoter PRSx8
  • Tags / Fusion Proteins
    • P2A (C terminal on insert)
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer PRSx8 F: CAGGTGGGACCAGAGAGCTCACCC
  • 3′ sequencing primer GFP F: CAAAGACCCCAACGAGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    AstR sequence was cloned from addgene plasmid #14895

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid features: AstR: 338 -1521, P2A: 1529 -1597, GFP: 1598 -2311 ,WPRE: 2373- 2969

Please note: Plasmid contains a 16bp deletion at the start of L-ITR. This deletion has no functional effect on the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTYF-PRSx8-AstR-p2A-GFP was a gift from Andrew Allen (Addgene plasmid # 159632 ; http://n2t.net/addgene:159632 ; RRID:Addgene_159632)
  • For your References section:

    A Chemogenetic Tool that Enables Functional Neural Circuit Analysis. Ngo HB, Melo MR, Layfield S, Connelly AA, Bassi JK, Xie L, Menuet C, McDougall SJ, Bathgate RAD, Allen AM. Cell Rep. 2020 Sep 15;32(11):108139. doi: 10.1016/j.celrep.2020.108139. 10.1016/j.celrep.2020.108139 PubMed 32937120