Skip to main content
Addgene

pAM-DCA-HA-Ast-3-NP-1-IRES-mCherry-WPRE
(Plasmid #159630)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159630 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAM
  • Backbone size w/o insert (bp) 5364
  • Total vector size (bp) 7050
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Ast
  • Alt name
    Allatostatin-3, Ast,
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    1700
  • GenBank ID
    AE014297.3
  • Entrez Gene
    AstA (a.k.a. Dmel_CG13633, ALLS, AS, ASA, AST, AST-1, AST-3, AST-4, AST-A, Allatostatin A1, Allatostatin A2, Allatostatin A3, Allatostatin A4, Ast, Ast-A, AstA-1, AstA-2, AstA-3, AstA-4, AstA1, AstA2, AstA4, BcDNA:RE16553, CG13633, DAP, DAP-A, DST-1A, DST-2A, DST-3A, DST-4A, Dmel\CG13633, Drm-AST-1, Drm-AST-2, Drm-AST-3, Drm-AST-4, Drm-AST-A, ast)
  • Promoter DCA (same as CAG promoter)
  • Tags / Fusion Proteins
    • HA (N terminal on insert)
    • neurophysin-1 (C terminal on insert)
    • IRES (C terminal on insert)
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer HA F: TACCCATACGACGTCCCAGA
  • 3′ sequencing primer mCherry R: TTGGTCACCTTCAGCTTGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid features: CAG promoter: 271 -1152, Allatostatin: 1159- 1563, IRES: 1584- 2124, mCherry: 2155- 2859, WPRE: 2881- 3468

Please note: Plasmid contains K4M and G5D mutations in mCherry. These mutations do not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAM-DCA-HA-Ast-3-NP-1-IRES-mCherry-WPRE was a gift from Andrew Allen & Ross Bathgate (Addgene plasmid # 159630 ; http://n2t.net/addgene:159630 ; RRID:Addgene_159630)
  • For your References section:

    A Chemogenetic Tool that Enables Functional Neural Circuit Analysis. Ngo HB, Melo MR, Layfield S, Connelly AA, Bassi JK, Xie L, Menuet C, McDougall SJ, Bathgate RAD, Allen AM. Cell Rep. 2020 Sep 15;32(11):108139. doi: 10.1016/j.celrep.2020.108139. 10.1016/j.celrep.2020.108139 PubMed 32937120