pAM-DCA-HA-Ast-3-NP-1-IRES-mCherry-WPRE
(Plasmid #159630)

• Purpose: AAV expression of HA Allatostatin-3, neurophysin, IRES mCherry under the CAG promoter
• Depositing Labs: Andrew Allen, Ross Bathgate
• Publication: Ngo et al Cell Rep. 2020 Sep 15;32(11):108139. doi: 10.1016/j.celrep.2020.108139.

Backbone

• Vector backbone: pAM
• Backbone size w/o insert (bp): 5364
• Total vector size (bp): 7050
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Ast
• Alt name: Allatostatin-3, Ast,
• Species: D. melanogaster (fly)
• Insert Size (bp): 1700
• GenBank ID: AE014297.3
• Entrez Gene: AstA (a.k.a. Dmel_CG13633, ALLS, AS, ASA, AST, AST-1, AST-3, AST-4, AST-A, Allatostatin A1, Allatostatin A2, Allatostatin A3, Allatostatin A4, Ast, Ast-A, AstA-1, AstA-2, AstA-3, AstA-4, AstA1, AstA2, AstA4, BcDNA:RE16553, CG13633, DAP, DAP-A, DST-1A, DST-2A, DST-3A, DST-4A, Dmel\CG13633, Drm-AST-1, Drm-AST-2, Drm-AST-3, Drm-AST-4, Drm-AST-A, ast)
• Promoter: DCA (same as CAG promoter)
• Tags / Fusion Proteins:
  • HA (N terminal on insert)
  • neurophysin-1 (C terminal on insert)
  • IRES (C terminal on insert)
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: HA F: TACCCATACGACGTCCCAGA
• 3′ sequencing primer: mCherry R: TTGGTCACCTTCAGCTTGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid features: CAG promoter: 271 -1152, Allatostatin: 1159- 1563, IRES: 1584- 2124, mCherry: 2155- 2859, WPRE: 2881- 3468

Please note: Plasmid contains K4M and G5D mutations in mCherry. These mutations do not affect plasmid function.