Skip to main content
Addgene

pAAV-CAG-SomaGCaMP6f2
(Plasmid #158757)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158757 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart
AAV8 158757-AAV8 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. $405
Add to Cart
AAV9 158757-AAV9 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. $405
Add to Cart

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4735
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SomaGCaMP6f2
  • Alt name
    GCaMP6f
  • Alt name
    GCaMP6
  • Species
    Synthetic
  • Insert Size (bp)
    1701
  • Promoter CAG promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
  • 3′ sequencing primer GGCATTAAAGCAGCGTATCC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Information for AAV8 (Catalog # 158757-AAV8) ( Back to top)

Purpose

Ready-to-use AAV8 particles produced from pAAV-CAG-SomaGCaMP6f2 (#158757). In addition to the viral particles, you will also receive purified pAAV-CAG-SomaGCaMP6f2 plasmid DNA.

CAG-driven expression of soma-targeting GCaMP6f2. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV8 cap gene
  • Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
  • Serotype AAV8
  • Purification Iodixanol gradient ultracentrifugation

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV9 (Catalog # 158757-AAV9) ( Back to top)

Purpose

Ready-to-use AAV9 particles produced from pAAV-CAG-SomaGCaMP6f2 (#158757). In addition to the viral particles, you will also receive purified pAAV-CAG-SomaGCaMP6f2 plasmid DNA.

CAG-driven expression of soma-targeting GCaMP6f2. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
  • Buffer PBS + 0.001% Poloxamer 188
  • Serotype AAV9
  • Purification Iodixanol gradient ultracentrifugation

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CAG-SomaGCaMP6f2 was a gift from Edward Boyden (Addgene plasmid # 158757 ; http://n2t.net/addgene:158757 ; RRID:Addgene_158757) For viral preps, please replace (Addgene plasmid # 158757) in the above sentence with: (Addgene viral prep # 158757-AAV8) or (Addgene viral prep # 158757-AAV9)

  • For your References section:

    Precision Calcium Imaging of Dense Neural Populations via a Cell-Body-Targeted Calcium Indicator. Shemesh OA, Linghu C, Piatkevich KD, Goodwin D, Celiker OT, Gritton HJ, Romano MF, Gao R, Yu CJ, Tseng HA, Bensussen S, Narayan S, Yang CT, Freifeld L, Siciliano CA, Gupta I, Wang J, Pak N, Yoon YG, Ullmann JFP, Guner-Ataman B, Noamany H, Sheinkopf ZR, Park WM, Asano S, Keating AE, Trimmer JS, Reimer J, Tolias AS, Bear MF, Tye KM, Han X, Ahrens MB, Boyden ES. Neuron. 2020 Jun 26. pii: S0896-6273(20)30398-6. doi: 10.1016/j.neuron.2020.05.029. 10.1016/j.neuron.2020.05.029 PubMed 32592656
Related items:
Commonly requested with: