pAAV-Syn-nullCoChR-GCaMP6f-Kv2.1
(Plasmid
#158758)
-
PurposeCell body-targeted GCaMP6f, under synapsin promoter: nullCoChR (the optogenetic protein CoChR mutated to have 0 current), followed by GCaMP6f and the KV2.1 motif (nullCoChR-GCaMP6f-Kv2.1).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 158758 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4281
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenullCoChR-GCaMP6f-Kv2.1
-
Alt nameGCaMP6f
-
Alt nameGCaMP6
-
SpeciesSynthetic
-
Insert Size (bp)2454
- Promoter synapsin promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCGACCATCTGCGCTGC
- 3′ sequencing primer GGCATTAAAGCAGCGTATCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Syn-nullCoChR-GCaMP6f-Kv2.1 was a gift from Edward Boyden (Addgene plasmid # 158758 ; http://n2t.net/addgene:158758 ; RRID:Addgene_158758) -
For your References section:
Precision Calcium Imaging of Dense Neural Populations via a Cell-Body-Targeted Calcium Indicator. Shemesh OA, Linghu C, Piatkevich KD, Goodwin D, Celiker OT, Gritton HJ, Romano MF, Gao R, Yu CJ, Tseng HA, Bensussen S, Narayan S, Yang CT, Freifeld L, Siciliano CA, Gupta I, Wang J, Pak N, Yoon YG, Ullmann JFP, Guner-Ataman B, Noamany H, Sheinkopf ZR, Park WM, Asano S, Keating AE, Trimmer JS, Reimer J, Tolias AS, Bear MF, Tye KM, Han X, Ahrens MB, Boyden ES. Neuron. 2020 Jun 26. pii: S0896-6273(20)30398-6. doi: 10.1016/j.neuron.2020.05.029. 10.1016/j.neuron.2020.05.029 PubMed 32592656