pCAGGS-Halotag-loxP-P2A-dTKneo-pA-loxP
(Plasmid #139485)

• Purpose: PCR template for Halo-Tag gene knock-in donor vector
• Depositing Lab: Kazuhiro Aoki
• Publication: Komatsubara et al J Biol Chem. 2019 Apr 12;294(15):6062-6072. doi: 10.1074/jbc.RA119.007685. Epub 2019 Feb 9.

Backbone

• Vector backbone: pCAGGS
• Backbone manufacturer: Junichi Miyazaki (Osaka University, Japan)
• Backbone size w/o insert (bp): 4870
• Total vector size (bp): 7969
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HaloTag-loxP-P2A-dTKneo-pA-loxP
• Alt name: dTKneo: deleted thymidine kinase gene fused with neo gene for positive and negative selection
• Species: Synthetic
• Promoter: CAG promoter
• Tag / Fusion Protein:
  • HaloTag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: catgttcatgccttcttctttttcc
• 3′ sequencing primer: agatgctcaaggggcttcatgatg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry