Skip to main content
Addgene

pF CAG luc hygro
(Plasmid #67502)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67502 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pF MCS hygro
  • Backbone size w/o insert (bp) 11145
  • Total vector size (bp) 12807
  • Vector type
    Mammalian Expression, Lentiviral, Luciferase
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    LB broth
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Firefly luciferase
  • Alt name
    luc
  • Species
    Firefly
  • Insert Size (bp)
    1662
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GCAACGTGCTGGTTGTTGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pF CAG luc hygro was a gift from Brett Stringer (Addgene plasmid # 67502 ; http://n2t.net/addgene:67502 ; RRID:Addgene_67502)
  • For your References section:

    A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma. Stringer BW, Day BW, D'Souza RCJ, Jamieson PR, Ensbey KS, Bruce ZC, Lim YC, Goasdoue K, Offenhauser C, Akgul S, Allan S, Robertson T, Lucas P, Tollesson G, Campbell S, Winter C, Do H, Dobrovic A, Inglis PL, Jeffree RL, Johns TG, Boyd AW. Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z. 10.1038/s41598-019-41277-z PubMed 30894629