pFastBac HT JS-Rab10wt
(Plasmid
#135557)
-
PurposeExpress mouse Rab10wt in Sf9 cells, the resulted plasmid encodes an N-terminally His6-tagged Munc18c protein with a tobacco etch virus (TEV) cleavage site between the His6 tag and Rab10wt.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135557 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFastBac
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRab10
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)603
- Promoter polyhedrin promoter
-
Tag
/ Fusion Protein
- 6xHis tag, TEV site (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer polyhedrin promoter
- 3′ sequencing primer TAAGCTGCAATAAACAAGTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastBac HT JS-Rab10wt was a gift from Jingshi Shen (Addgene plasmid # 135557 ; http://n2t.net/addgene:135557 ; RRID:Addgene_135557) -
For your References section:
RABIF/MSS4 is a Rab-stabilizing holdase chaperone required for GLUT4 exocytosis. Gulbranson DR, Davis EM, Demmitt BA, Ouyang Y, Ye Y, Yu H, Shen J. Proc Natl Acad Sci U S A. 2017 Sep 26;114(39):E8224-E8233. doi: 10.1073/pnas.1712176114. Epub 2017 Sep 11. 10.1073/pnas.1712176114 PubMed 28894007