pDX_init containing Sb-loop
(Plasmid
#132697)
-
PurposepDX_init plasmid containing a loop Sybody for the generation of a qPCR standard curve
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132697 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDX_init
-
Vector typeM13 Phagmid vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSb_loop
-
SpeciesSynthetic
- Promoter lac
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TTATGCTTCCGGCTCGTATG
- 3′ sequencing primer CTATGAGGGCTGTCTGTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDX_init containing Sb-loop was a gift from Markus Seeger (Addgene plasmid # 132697 ; http://n2t.net/addgene:132697 ; RRID:Addgene_132697) -
For your References section:
Generation of synthetic nanobodies against delicate proteins. Zimmermann I, Egloff P, Hutter CAJ, Kuhn BT, Brauer P, Newstead S, Dawson RJP, Geertsma ER, Seeger MA. Nat Protoc. 2020 Apr 8. pii: 10.1038/s41596-020-0304-x. doi: 10.1038/s41596-020-0304-x. 10.1038/s41596-020-0304-x PubMed 32269381