pBXNH3CA_MBP
(Plasmid
#132700)
-
Purposeexpresses Avi-tagged MBP in E.coli, to use as positive control in ELISA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132700 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBXNH3CA
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMaltose binding Protein
-
SpeciesEscherichia coli
- Promoter pBAD
-
Tags
/ Fusion Proteins
- His (N terminal on backbone)
- Avi (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BspQI (not destroyed)
- 3′ cloning site BspQI (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBXNH3CA_MBP was a gift from Markus Seeger (Addgene plasmid # 132700 ; http://n2t.net/addgene:132700 ; RRID:Addgene_132700) -
For your References section:
Generation of synthetic nanobodies against delicate proteins. Zimmermann I, Egloff P, Hutter CAJ, Kuhn BT, Brauer P, Newstead S, Dawson RJP, Geertsma ER, Seeger MA. Nat Protoc. 2020 Apr 8. pii: 10.1038/s41596-020-0304-x. doi: 10.1038/s41596-020-0304-x. 10.1038/s41596-020-0304-x PubMed 32269381