Skip to main content
Addgene

pmKikGR Vinculin
(Plasmid #105316)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105316 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pmKikGRNB
  • Backbone manufacturer
    modified pEGFP-C1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    vinculin
  • Alt name
    VCL
  • Alt name
    NM_205441
  • Species
    G. gallus (chicken)
  • Insert Size (bp)
    3200
  • Entrez Gene
    VCL (a.k.a. VINC1)
  • Tag / Fusion Protein
    • KikGR (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site Xba1 (unknown if destroyed)
  • 5′ sequencing primer TCCAGTTGCCAGACTATCAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pmKikGR was constructed by inserting sequence corresponding to mKikGR with Kozak sequence to replace EGFP in Nhe1 /BglII sites of pEGFP NBC1. Vinculin cDNA was from Dr. Benjamin Geiger (Weizmann Institute) and mKikGR was from Dr. Atsushi Miyawaki (Riken BSI).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmKikGR Vinculin was a gift from Kenneth Yamada (Addgene plasmid # 105316 ; http://n2t.net/addgene:105316 ; RRID:Addgene_105316)
  • For your References section:

    Micro-environmental control of cell migration--myosin IIA is required for efficient migration in fibrillar environments through control of cell adhesion dynamics. Doyle AD, Kutys ML, Conti MA, Matsumoto K, Adelstein RS, Yamada KM. J Cell Sci. 2012 May 1;125(Pt 9):2244-56. doi: 10.1242/jcs.098806. Epub 2012 Feb 10. 10.1242/jcs.098806 PubMed 22328520