We narrowed to 47 results for: cat
-
TypeProtocol... Protocols DNA Quantification DNA Quantification You may also like... Addgene’s DNA Quantification Protocol. Protocols... to protein (260/280) is generally used as an indicator of the purity of DNA samples. These days, many...
-
CRISPR Library Amplification
TypeProtocol... Protocols CRISPR Library Amplification CRISPR Library Amplification You may also like... Pooled libraries...quantities of library for experimental applications. Repeated amplifications should be avoided as best as possible...Follow this protocol to perform amplification of CRISPR pooled plasmid libraries in Escherichia coli ...refer to our pooled library material pages for amplification protocols that have been developed by the depositor...available. If a pooled library does not yet have an amplification protocol, the following protocol can be used... CRISPR libraries. This protocol allows the amplification of a pooled-plasmid library in Escherichia coli...genes in an organism's genome, for example. Amplification is usually necessary to produce sufficient quantities... -
AAV Purification by Iodixanol Gradient Ultracentrifugation
TypeProtocol.... The arrow indicates the 60–40% interface. The vertical black line indicates the location of the purified... Protocols AAV Purification by Iodixanol Gradient Ultracentrifugation AAV Purification by Iodixanol Gradient...isomolar density gradient medium suitable for virus purification and isolation of cells, organelles, lipoproteins...and use an iodixanol column gradient for AAV purification. Workflow Timeline Day 1: Purify Day 2: Buffer..., et al. "Recombinant adeno-associated virus purification using novel methods improves infectious titer...opens in a new window) . Right panel: cartoon indicating the position of the needle for harvesting of ... -
Plasmid Modification by Annealed Oligo Cloning (with Protocols)
TypeProtocol... Protocols Plasmid Modification by Annealed Oligo Cloning Plasmid Modification by Annealed Oligo Cloning...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...compliment so that they can anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo... final oligos 34 bp each: Top oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3... -
Affinity Purification of Recombinant Antibodies with Protein A or Protein G
TypeProtocol...Affinity Purification with Protein A or Protein G Recombinant Antibody Affinity Purification with Protein... -
Plasmid Cloning by PCR (with Protocols)
TypeProtocol...Vector by Gel Purification Run your digest DNA on an agarose gel and conduct a gel purification to isolate...not cut within your insert. Are in the desired location in your recipient plasmid (usually in the Multiple...amplify and design primers that will bind to and replicate it. The following image shows the ends of the ...Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and...primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'. Many restriction enzymes do not cut...final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design...need to use the reverse complement to get PCR amplification. We can start similarly, taking the final 18bases... -
Using a Light Microscope Protocol
TypeProtocol...10x magnification. To determine the final magnification of your image, multiply the magnification of your...most important properties of a microscope are magnification (the ability to make an image larger) and resolution...reaches your eyes. These lenses determine the magnification of the image and the resolution your microscope...information, but the most important (for now) is the magnification power, such as 4x, 10x, or 20x. A 4x objective...times, and so on. The ocular lens also provides magnification and the power should be provided on the microscope... your objective lens by the magnification of your ocular lens. For example, if you observe something using...positioning and focus of your image on the lowest magnification, you are ready to move up to the next objective... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol... all publications arising from the use of this vector. A.2 Map of pLKO.1 pLKO.1 is a replication-incompetent...terminal repeat. f1 ori f1 bacterial origin of replication. Amp R Ampicillin resistance gene for selection...bacterial cells pUC ori pUC bacterial origin of replication. 5’LTR 5’ long terminal repeat. RRE Rev response... 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’...AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to Top C. Cloning Oligos into pLKO... C.1 Recommended Materials Material Vendor and catalog # AgeI New England Biolabs (NEB) #R0552S EcoRI ... D.1 Recommended Materials Material Vendor and catalog # DNA Miniprep Kit Qiagen #27104 EcoRI NEB #R0101S... -
Protocols for Molecular Biology, Plasmid Cloning, and Viral Preps
TypeProtocol...Video! DNA Purification Miniprep, phenol-chloroform extract, and precipitate DNA DNA Quantification Measure...protocols that you can use for a wide range of applications, with videos for select protocols in the right-hand...protocols are the building blocks for many more complicated procedures. Plasmid Cloning Protocols for constructing...preparations. Antibodies Protocols for common antibody applications. Intro to the Lab Bench Name Description (Link...bacterial strain Watch the Video! CRISPR Library Amplification Amplify CRISPR pooled-plasmid libraries Diagnostic...Cloning by PCR Generate restriction sites by PCR Modification by Annealed Oligo Cloning Add a short stretch...your gene of to the target of your choice AAV Purification by Iodixanol Gradient Ultracentrifugation Purify... -
Plasmid Cloning by Restriction Enzyme Digest (with Protocols)
TypeProtocol...vector by gel purification Run your digested DNA on an agarose gel and conduct a gel purification to isolate... not cut within your insert Are in the desired location in your recipient plasmid (usually in the Multiple...plasmids. Because you lose some DNA during the gel purification step, it is important to digest plenty of starting...prior to the ligation step or prior to the gel purification step, depending on the phosphatase you choose...isolate the DNA. When running a gel for purification purposes it is important to have nice crisp bands and...bands away from the gel via your favorite gel purification method, it is important to determine the concentration...from your transformation will give you the first indication as to whether your transformation worked. our... -
AAV Titration by qPCR Using SYBR Green Technology
TypeProtocol...Load 5 μL of each standard in duplicate Load 5 μL of each sample in duplicate. Do not forget to include a...dilution is appropriate). Quality of duplicates: Exclude duplicates from analyses if there is more than...Considerations Always run standards and samples in duplicate at least If possible, include an AAV reference...standard with DNase ** Make 6 serial dilutions, in duplicate, of your standard curve plasmid (2 x 10 9 stock...second peak at a temperature of ~70–75 °C usually indicates the presence of primer dimers which can increase...point standard curve. Figure 2: Example of the amplification plots obtained from an AAV sample. Each curve...Universal real-time PCR for the detection and quantification of adeno-associated virus serotype 2-derived... -
Kit Free RNA Extraction
TypeProtocol...You may also like... Kit-Free DNA Purification Agarose Gel Purification Molecular Biology Reference Introduction...information on nucleic acid quantification, see our protocol for DNA quantification , which can be modified... not affect the quality of RNA or downstream applications. To improve yield of RNA, instead of incubating... -
AAV Production in HEK293 Cells
TypeProtocol... of sonication to avoid overheating of the sample. Mix well between rounds of sonication. Sonicate until...container pH meter Stir plate Magnetic stir bar Sonicator Ear protection Vortex Reagents Adherent HEK293T...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 1 ... layers are covered with media. 293T cells are delicate and detach very easily - media should always be...completely. Combine all resuspended cell pellets and sonicate 5 x 1 sec pulses with at least 5 minutes on ice...overnight at 4 °C before proceeding with the purification protocol. Sample Data Figure 1: HEK293T cells... -
Protocol - How to Purify DNA from an Agarose Gel
TypeProtocol...Electrophoresis DNA Ligation Background Information Gel purification allows you to isolate and purify DNA fragments...restriction enzyme -based cloning. Protocol: Gel Purification Follow the Agarose Gel Electrophoresis Protocol...Protocol with the following amendments: Notes: Gel purification is most efficient with lower % agarose gels,... This is especially important during the DNA purification step, as many kits cannot handle more than a... is most commonly done with a commercial gel purification kit, such as the (Link opens in a new window...purified DNA. Find more information about DNA quantification here . Tips and FAQ How do you get better resolution... -
Western Blot
TypeProtocol...Immunocytochemistry Protocol Recombinant Antibody Purification Protocol Introduction Western blot is a technique...lysis buffer will vary depending on the cellular location of the protein of interest. RIPA buffer is suitable...most proteins but more stringent buffers and a sonication step may be required for hard to extract proteins...BSA standard that range from 0–2000 µg/mL . In duplicate, dilute 10 µL of standard, blank, and lysate samples... nm . Calculate the average absorbance of the duplicate samples on the plate. Subtract the average absorbance...vary depending on the sample type and cellular location of the protein of interest. You may need to try... -
Protocol - How to Perform Sequence Analysis
TypeProtocol...Although your sequencing results may indicate bases at specific locations, by looking at the trace file, you...Diagnostic Restriction Digest Introduction Sequence verification of important plasmid features (such as the gene...file and use the search feature in the program to locate the incorrect sequence. Look at the peaks in the...after base 70 there are multiple peaks in the same location. Looking at the trace file will give you more... -
Ligation Independent Cloning
TypeProtocol... plasmid together through the transformation/replication process. LIC employs long overhangs to form a...nicked vector product is then repaired during the replication cycle. Empty vectors for LIC typically employ...mixture by gel electrophoresis followed by gel purification . The cut vector end will now look like this...μl Step 4: Amplify Insert by PCR Perform PCR amplification of your insert following the instructions provided...following step. This may be accomplished by gel purification . Step 5: Create Insert Overhangs Treat your... -
Video Library
TypeProtocol... Educational Resources Addgene Videos Addgene Videos Browse...lab Over-Agar Antibiotic Plating Protocol AAV Purification Purify adeno-associated virus from a preparation...preparation produced in mammalian cells AAV Purification by Iodixanol Gradient Ultracentrifugation Protocol...separating DNA by size for visualization and purification. Agarose Gel Electrophoresis Protocol Purifying...Purifying DNA from an Agarose Gel Gel purification allows you to isolate and purify DNA fragments based on... -
Lentivirus ddPCR Titration
TypeProtocol... sample. This protocol was modified from the publication Wang et al. (2018) . Before Starting Thaw the...Scientific, 10199-452 Reagents GeneJet Genomic DNA Purification Kit, Thermo Fisher, K0721 6-well tissue culture...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) Trypsin...FAM): tttggaatcacacgacct reverse primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number Assay: RPP30...the next dilution. Repeat for all dilutions as indicated in the chart below. Dilution Factor Virus Volume...genomic DNA according to the GeneJet Genomic DNA Purification Kit instructions. Determine the concentration... -
Molecular Biology Protocol - Restriction Digest of Plasmid DNA
TypeProtocol...The amount of DNA that you cut depends on your application. A diagnostic digest typically involves ∼500 ...volume usually varies from 10-50 µL depending on application and is largely determined by the volume of DNA...manufacturer’s instructions. Pro-Tip Depending on the application and the amount of DNA in the reaction, incubation...you will be using the digested DNA for another application (such as a digestion with another enzyme in a...70 °C for 15 mins, or purifying the DNA via a purification kit, such as a (Link opens in a new window) ...