...Addgene's educational resources, including eBooks, science guides, videos, and protocols... Educational Resources...eBooks to videos and blog posts to protocols, our educational resources cover a wide range of topics in molecular...written and video protocols for a wide range of applications in molecular biology, plasmid cloning, and virus...

... Rabbit beta-globin polyA region, reverse primer CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol ...tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato, forward primer tdTomato-Rev TCTTTGATGACGGCCATGT 5' end ...primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end of WPRE, reverse primer XBG-R GACTCCATTCGGGTGTTC Xenopus beta-globin...sequencing primers that Addgene uses for sequence verification of deposited plasmids. Plasmid...used a number of primers for sanger sequence verification of deposited plasmids. Below is a list of commonly... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward... forward primer Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1...

...subsequently isolated by affinity purification against the epitope tag. After purification of the locus, molecules...conventional methods for genomic purification, CRISPR-based purification methods are more straightforward...protein through mutation of its catalytic domain. Fusions to catalytically inactive Cas13 can be used to...table above, 3' and 5' indicate on which end of targeted sequence the PAM is located. The majority of the...unintended genomic locations On-target activity Cas9 cleavage at a desired location specified by a gRNA...Resources Web References PAM Sequences Glossary Publications CRISPR Overview Class 2 C lustered R egularly...genes in various cell types and organisms, but modifications to various Cas enzymes have extended CRISPR ...

...Handling Visualization Signal Amplification Application Overview Quantification Methods Capture Methods Visualization...Antibody Applications Antibody-based applications can be generally classed into four categories: Quantification... Read on to learn more about the applications common to each category, including an outline of the basic...these applications, visit the Antibody section of the Addgene Protocols page. Antibody Applications - Quantification...concentrates in the sample. Controls for quantification methods Quantification methods should be run with: a positive...using sonication to break DNA up into fragments of 300-1000 bps in length. Note: This sonication process...production and storage techniques, and explain common applications. Science...

... Origin of Replication ( ori ) DNA sequence which directs initiation of plasmid replication (by bacteria... Educational Resources Molecular Biology Reference Molecular...plasmid selection DNA sequencing for plasmid verification Sanger Sequencing Next Generation Sequencing...Techniques in chemistry enable isolation and purification of cellular components, such as DNA, but practically...double-stranded DNA that typically carry genes and can replicate independently from chromosomal DNA. Although they...the bacterial chromosomal DNA, plasmid DNA is replicated upon cell division, and each daughter cell receives...manipulating genes. For instance, most plasmids are replicated in E. coli and are relatively small (∼3000 - ...

...therapeutic applications. Clinical trials using AAV for various gene delivery applications are currently...adenovirus. These genes (E4, E2a and VA) mediate AAV replication. The transfer plasmid, Rep/Cap, and the helper...integrations may occur at a much lower frequency. As a replication-incompetent virus, AAV cannot enter the lytic...double stranded synthesis. These episomes can concatemerize, producing high molecular weight structures ... are thought to be maintained in episomes or concatemers. Episomes differ profoundly from viral particles...gives a summary of the tropism of AAV serotypes, indicating the optimal serotype(s) for transduction of a...serotypes are denoted using a slash, so that AAV2/5 indicates a virus containing the genome of serotype 2 packaged...

...Channelrhodopsins: cation channels from Chlamydomonas reinhardtii ChR2 Widely used light-gated cation channel from...light of the correct wavelength, the pore opens, cations flow into the cell (yellow dots), and the neuron...reporters of molecular signals; e.g., calcium indicators In this overview, we will focus on the common... electrochemical responses, such as nonspecific cation influx vs. proton efflux. Researchers have used...is excited by blue light and permits nonspecific cation influx into the cell when stimulated. Channelrhodopsin...optogenetic tool, is also a blue light activated cation channel. ChR2 is preferred over ChR1 because ChR2...been expanded by scientists through both the identification of novel ChRs from other algal species and ...

...adenoviruses replication deficient? Typically yes, because the early genes necessary for replication have been...events creating replication-competent virus increases with each round of amplification. What is RCA? RCA...deletion from the viral vector renders the virus replication incompetent. E3 is involved in evading host immunity...presence of adenoviral genes E1, E4, E2a and VA for replication. For more information about AAV, read our AAV... line (either 293 or 911). To avoid creating replication competent virus, you should not serially propagate... RCA stands for r eplication c ompetent a denovirus. This may occur when a crossover event between your...crossover event increases with each round of amplification. Where can I find information about using the...

...For safety reasons, transfer plasmids are all replication incompetent and may contain an additional deletion...Interchangeable: usually encodes for VSV-G Safety Safe. Replication incompetent: Uses 3 separate plasmids encoding...encoding various HIV genes. Safer. Replication incompetent and always SIN: Uses 4 plasmids instead of 3 and...comparing the lentivirus HIV and the retrovirus MMLV indicate that the viral integrase plays a role in shaping...lentiviral are: The potential for generation of replication-competent lentivirus The potential for oncogenesis...oncogenesis The potential for generation of replication-competent lentivirus is addressed by the design of...viruses normally produced from these systems to replicate and produce more virus after the initial infection...

... Pooled Library Amplification Protocol for Addgene's generalized library amplification protocol. Read ...: Pooled Library Guide Introduction Library Amplification Types of Screens Resources An Introduction to..., semi-random sequences that can be used for applications like lineage tracing or parsing the effects ...of each cell carrying it as being a biological replicate for that plasmid. Library screens can be divided...

...polymerase. DNA sequences called response elements are located within promoter regions, and they provide a stable...cells. Core Promoter The core promoter region is located most proximal to the start codon and contains the...Promoters in bacteria contain two short DNA sequences located at the -10 (10 bp 5' or upstream) and -35 positions...eukaryotic TATA box, the Pribnow box (TATAAT) is located at the -10 position and is essential for transcription...

...interest and then insert them into plasmids for replication and protein expression. So how do scientists ...restriction sites to any piece of DNA during PCR amplification, allowing for it to then be digested and ligated...cut your insert or backbone at only the desired location for your cloning project. Restriction enzyme cloning...where the nicks will be repaired by the normal replication process. It is important to note that LIC has...

...neurons) that can be turned on or off by the application of a small molecule ligand. The ideal chemogenetic...muscarinic Arrestin-2/-3 CNO* Increase Arrestin translocation Arrestin signalling Nakajima & Wess, 2012 hM3Dq...chemogenetics for research and potential clinical applications. Science: 364(6436):eaav5282. PMID: 30872534... KM, Brown KM, Forbes SL, Liggett SB (2001). Modification of the beta 2-adrenergic receptor to engineer...

...specific binding to other proteins. Antibody-based applications, which often use antibodies conjugated to a ...certain gene sets. Read More Viral Vectors Find educational guides to learn more about the different types...

...contains an introduction to each vector and its applications, tips for using vectors in your experiments,...your transferable skills, and tips on the job application process. Close About Overlay Select CRISPR 101...

...read our lentivirus guide. Are γ-retroviruses replication incompetent? Yes, as with lentiviruses, the genes...