...forward primer SP6 ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward...Pry1 CTTAGCATGTCCGTGGGGTTTGAAT PZ P-element, reverse primer pTrcHis Forward GAGGTATATATTAATGTATCG (Invitrogen... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...forward primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer M13 Reverse CAGGAAACAGCTATGAC... stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of...resistance gene, reverse primer AUG1 Forward CAATTTACATCTTTATTTATTAACG (Invitrogen) For Pichia vectors with AUG1...AUG1 promoter, forward primer AUG1 Reverse GAAGAGAAAAACATTAGTTGGC (Invitrogen) For Pichia vectors with AUG1...

...detect simultaneously. Conjugation The process of attaching signaling molecules to an antibody is done through...direct ELISAs, an antigen or protein of interest is attached to the well of a 96-well plate. A conjugated primary...recognize the protein in its native conformation. Attachment of the antibody to the beads is typically done...

..., 481–485. PMID: 26098369 Kleinstiver, B. P., Pattanayak, V., Prew, M. S., Tsai, S. Q., Nguyen, N. T.,...PMID: 25398340 Walton, R. T., Christie, K. A., Whittaker, M. N., & Kleinstiver, B. P. (2020). Unconstrained...Daringer, N. M., Freije, C. A., Myhrvold, C., Bhattacharyya, R. P., Livny, J., Regev, A., Koonin, E. V.,... Naito, Y., Nakada, S., Yamamoto, T., Sano, S., Hotta, A., Takeda, J., & Mashimo, T. (2019). CRISPR-Cas3...

...barcode, and amplified. These DNA fragments are attached to a glass slide so that different fragments of...are spatially separated from each other. These attached DNA templates are then amplified again producing...

...amplified with specific Gateway attB1 and attB2 sites attached to the 5’ and 3’ ends of DNA sequence. This fragment...

...that bind to the LOV domain only in the dark. attaching only one member of the Zdk/LOV2 pair to the target...