We narrowed to 17 results for: sta
-
TypeGuide...as NEB Stable cells. These strains reduce the frequency of homologous recombination of unstable regions...of a transgene. Stable Cell Lines Gamma-retroviral vectors are often used to make stable cell lines. Like...markers, such as the puromycin resistance gene, conferring antibiotic resistance to infected host cells. When...and replicate. This feature can be harnessed for stable delivery of various genes, mutations, or treatments... in a variety of cell types and models, such as stable long-term expression in a host and low immunogenicity...specific to each virus type. From an experimental standpoint, the main difference between lentiviruses and...into the transfer plasmid can be done with most standard cloning methods, including restriction enzyme,...
-
Molecular Biology Reference
TypeGuide...populations, an antibiotic resistance gene (i.e., a gene whose product confers resistance to ampicillin) is included...efficiently in a laboratory setting. Stable - Plasmids are stable long-term either as purified DNA or ...dideoxy sequencing. To understand Sanger sequencing, we first need to understand DNA replication. DNA is... GUA, GUG Start AUG* Stop UAG (amber), UGA (opal), UAA (ochre) *AUG is the most common start codon. Alternative...purposes of isolating one specific DNA sequence. This obstacle has been overcome by the field of recombinant ...providing a benefit to the host, such as antibiotic resistance. This benefit can be context-dependent, and thus...their use of studying and manipulating genes. For instance, most plasmids are replicated in E. coli and are... -
Lentiviral Vector Guide
TypeGuide...as NEB Stable cells. These strains reduce the frequency of homologous recombination of unstable regions...and clinical tools. Stable Cell Lines Lentiviral vectors can be used to make stable cell lines due to their...markers, such as the puromycin resistance gene, conferring antibiotic resistance to infected host cells. When...and replicate. This feature can be harnessed for stable delivery of various genes, mutations, or treatments...Lentiviral vectors can target non-dividing cells, enable stable long-term expression in a host, and exhibit low...contain packaging genes. From an experimental standpoint, the main difference between lentiviruses and...into the transfer plasmid can be done with most standard cloning methods, including restriction enzyme,... -
Antibody Guide
TypeGuide... the constant region, and is shown in dark blue and dark orange. The constant region is a stable part ...antibody’s constant region - specifically, it is determined by a region called the “heavy chain constant region...techniques use a nuclear stain, such as DAPI, to identify individual cells. These stains also emit fluorescent...sequencing, and enables the variable region and constant regions of the antibody to be independently manipulated...Structure Figure 1: Structure of an antibody A standard antibody is made up of four protein chains: two...responsible for producing antibodies, can change the constant region, and therefore change the isotype of antibodies...capable of recognizing and binding epitopes on constant regions of other antibodies. This has useful research... -
CRISPR Guide
TypeGuide...used to install the LSR Bxb1’s landing site into the genome at a desired locus, then Bxb1 installs the donor...including resistances to chemotherapy drugs and toxins, cell viability, and tumor metastasis. One of the...genome-wide screens. This guide will provide a basic understanding of CRISPR biology, introduce the various applications...applications of CRISPR, and help you get started using CRISPR in your own research. CRISPR Basics In this...target cleavage, while mismatches toward the 5′ end distal to the PAM often permit target cleavage. Generating... Cas9 orthologs are available. SaCas9 (from Staphylococcus aureus ) has a coding sequence ~1 kb shorter...addition of a structured motif to enhance pegRNA stability PEmax - optimized PE architecture; increased synergy... -
Adeno-associated virus (AAV) Guide
TypeGuide...as NEB Stable cells. These strains reduce the frequency of homologous recombination of unstable regions...overcome this obstacle, has been to use smaller Cas9 orthologs, such as SaCas9 from Staphylococcus aureus ....into the transfer plasmid can be done with most standard cloning methods, including restriction enzyme,...Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning...AAVs cannot enter the lytic cycle, and instead establish latent infections by integrating into the host...years without damaging the host cell. Episomal stability allows for long-term transgene expression in non-dividing...well characterized and are often preferred over standard rAAV vectors for in vivo applications. Other Engineered... -
Promoters
TypeGuide... the start codon and contains the RNA polymerase binding site, TATA box, and transcription start site ...factors bind. Distal Promoter The final portion of the promoter region is called the distal promoter which...located within promoter regions, and they provide a stable binding site for RNA polymerase and transcription...promoter: core promoter, proximal promoter, and distal promoter. Below describes the specifics of these...polymerase will bind to this core promoter region stably and transcription of the template strand can initiate...transcription. The most 3' portion (closest to the gene's start codon) of the core promoter is the TSS which is ...which is upstream of the proximal promoter. The distal promoter also contains transcription factor binding... -
Plan Your Experiment
TypeGuide...Once you have a clear understanding of your experimental goal, you are ready to start designing the specific...This page provides a general framework to get you started using CRISPR in your research and setting up CRISPR...aware that there could be downstream translation start sites that could allow for expression of a truncated...elongation. CRISPR Activation : Target the transcription start site. CRISPRa requires dCas9 to be fused to transcriptional...to be within a given range of the transcription start site in order to function effectively. Select gRNAs...into plasmids containing the gRNA scaffold using standard restriction-ligation cloning. However, the exact...experiment) and the expression time (transient or stable). For plasmid and viral-based approaches, the species... -
Modular Cloning Guide
TypeGuide...GoldenBraid, and PhytoBricks standards. CyanoGate Kit Bacterial Expression Alistair McCormick Kit containing... of 4 bp. If each DNA module is flanked with a standard overhang sequence at the restriction cut site,...number of libraries containing pre-constructed standardized modules. In the first assembly step, compatible...Marillonnet 95 plasmids for cloning and assembling standardized parts to create eukaryotic multigene constructs... Parts Kit Plant Expression Nicola Patron 95 standardized parts specific for plant synthetic biology. ...plants. MoClo-YTK Yeast Expression John Dueber 96 standardized and characterized parts that can be used for...lipolytica Golden Gate tool kit Yeast Expression Tristan Rossignol 64 plasmids to assemble and integrate... -
Adenovirus Guide
TypeGuide...as NEB Stable cells. These strains reduce the frequency of homologous recombination of unstable regions...transcripts are expressed after DNA replication starts and primarily encode for structural proteins needed...remain the most popular choice due to their well-established methods, relative simplicity of production, and...into the transfer plasmid can be done with most standard cloning methods, including restriction enzyme,...Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning...adenoviral backbone plasmid. One can also co-transform standard BJ5183 with supercoiled pAdEasy and the shuttle...candidates for multiple infectious diseases and prostate cancer. Cancer Treatment Recombinant adenoviral... -
Sequencing Primers
TypeGuide...neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene, ...Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward CAATTTACATCTTTATTTATTAACG...GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG...Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer pZIP TCCTTTCCAGCGAGGTTCTA...Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene, reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA... -
Optogenetics Guide
TypeGuide...control molecular signals and cells in order to understand their functions. Example schematic of an optogenetics...the brain and nervous system to better map and understand neuronal circuits. Optogenetic tools have also...disorder research, helping scientists to better understand Parkinson’s disease, depression, drug addiction...photocurrents 470 SFO/SSFO Step function Opsins and Stabilized Step Function Opsins. Mutations at C128 and D156...to “long lasting,” e.g. seconds to minutes with stable step-function opsins (SSFOs). Opsin delivery systems...opsin expression. Generally, the most robust and stable expression is achieved in a transgenic mouse line... -
Guide to Using Pooled Libraries
TypeGuide...CRISPR libraries include: resistance to the anti-cancer drug vemurafenib , resistance to Clostridium septicum... A well-designed screen can help you begin to understand what genes are important to a certain phenotype...septicum alpha-toxin , and resistance to to the nucleotide analog 6-thioguanine . Next-generation sequencing... -
Cloning
TypeGuide...dsDNA at a specified distance away from the recognition sequence. Cutting distal to their recognition ...This may be due to speed, cost, availability of starting materials or just personal preference. Check out... fragments you want to assemble before you get started. Check out Addgene's website for easy to use MoClo... -
Science Guides
TypeGuide...Addgene has created the following guides to help you start learning about various scientific concepts related...control molecular signals and cells in order to understand their functions. Read More Pooled Libraries Pooled... -
Addgene's eBook Collection
TypeGuide...Not sure where to start? Need a quick reference? Addgene's eBooks are here to help!... Collection Not sure where to start? Need a quick reference? Addgene's eBooks are here to help! 0 of 0... -
Chemogenetics Guide
TypeGuide...they also retain the ability to be activated by standard optogenetics workflows (such as laser or LED illumination...Planning Your Chemogenetics Experiment If you're starting to plan your chemogenetics experiment, here are...