Skip to main content
Addgene
Showing: 1 - 16 of 16 results
  1. Molecular Biology Reference

    Type
    Guide
    ...populations, an antibiotic resistance gene (i.e., a gene whose product confers resistance to ampicillin) is included...efficiently in a laboratory setting. Stable - Plasmids are stable long-term either as purified DNA or ...dideoxy sequencing. To understand Sanger sequencing, we first need to understand DNA replication. DNA is... GUA, GUG Start AUG* Stop UAG (amber), UGA (opal), UAA (ochre) *AUG is the most common start codon. Alternative...purposes of isolating one specific DNA sequence. This obstacle has been overcome by the field of recombinant ...providing a benefit to the host, such as antibiotic resistance. This benefit can be context-dependent, and thus...their use of studying and manipulating genes. For instance, most plasmids are replicated in E. coli and are...
  2. Antibody Guide

    Type
    Guide
    ... the constant region, and is shown in dark blue and dark orange. The constant region is a stable part ...antibody’s constant region - specifically, it is determined by a region called the “heavy chain constant region...techniques use a nuclear stain, such as DAPI, to identify individual cells. These stains also emit fluorescent...sequencing, and enables the variable region and constant regions of the antibody to be independently manipulated...Structure Figure 1: Structure of an antibody A standard antibody is made up of four protein chains: two...responsible for producing antibodies, can change the constant region, and therefore change the isotype of antibodies...capable of recognizing and binding epitopes on constant regions of other antibodies. This has useful research...
  3. Lentiviral Guide

    Type
    Guide
    ...From an experimental standpoint the main difference between lentiviruses and standard retroviruses (γ-retroviruses...homologous recombination of unstable regions, such as Invitrogen Stbl3™ or NEB Stable cells. This will ensure...lentivirus be used to make stable cell lines? Lentiviruses can be used to make stable cell lines in the same...as the puromycin resistance gene, conferring antibiotic resistance to infected host cells. When these ...non-dividing and actively dividing cell types whereas standard retroviruses can only infect mitotically active...types than retroviruses. Both lentiviruses and standard retroviruses use the gag, pol, and env genes for...same manner as standard retroviruses. That is, many lentiviral genomes have selectable markers, such as...
  4. CRISPR Guide

    Type
    Guide
    ...used to install the LSR Bxb1’s landing site into the genome at a desired locus, then Bxb1 installs the donor...including resistances to chemotherapy drugs and toxins, cell viability, and tumor metastasis. One of the...genome-wide screens. This guide will provide a basic understanding of CRISPR biology, introduce the various applications...applications of CRISPR, and help you get started using CRISPR in your own research. CRISPR Basics In this...target cleavage, while mismatches toward the 5′ end distal to the PAM often permit target cleavage. Generating... Cas9 orthologs are available. SaCas9 (from Staphylococcus aureus ) has a coding sequence ~1 kb shorter...addition of a structured motif to enhance pegRNA stability PEmax - optimized PE architecture; increased synergy...
  5. Promoters

    Type
    Guide
    ... the start codon and contains the RNA polymerase binding site, TATA box, and transcription start site ...factors bind. Distal Promoter The final portion of the promoter region is called the distal promoter which...located within promoter regions, and they provide a stable binding site for RNA polymerase and transcription...promoter: core promoter, proximal promoter, and distal promoter. Below describes the specifics of these...polymerase will bind to this core promoter region stably and transcription of the template strand can initiate...transcription. The most 3' portion (closest to the gene's start codon) of the core promoter is the TSS which is ...which is upstream of the proximal promoter. The distal promoter also contains transcription factor binding...
  6. Plan Your Experiment

    Type
    Guide
    ...Once you have a clear understanding of your experimental goal, you are ready to start navigating the different...generate stable cell lines (for details, see Plasmids 101: Mammalian Vectors ) Transient or stable expression...Expression System Design gRNA Publications Get Started CRISPR is a powerful system that enables researchers...section will provide a general framework to get you started using CRISPR in your research. Although we will...cell types (e.g. HEK293 cells), transfection with standard transfection reagents may be sufficient to express...details about lentivirus, see our Lentivirus Guide ) Stable, tunable expression of Cas9 and/or gRNA in a wide...compatible with smaller Cas enzymes) Transient or stable expression of SaCas9 and/or gRNA Infects dividing...
  7. Sequencing Primers

    Type
    Guide
    ...neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene, ...Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward CAATTTACATCTTTATTTATTAACG...GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG...Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer pZIP TCCTTTCCAGCGAGGTTCTA...Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene, reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA...
  8. Optogenetics Guide

    Type
    Guide
    ...control molecular signals and cells in order to understand their functions. Example schematic of an optogenetics...the brain and nervous system to better map and understand neuronal circuits. Optogenetic tools have also...disorder research, helping scientists to better understand Parkinson’s disease, depression, drug addiction...photocurrents 470 SFO/SSFO Step function Opsins and Stabilized Step Function Opsins. Mutations at C128 and D156...to “long lasting,” e.g. seconds to minutes with stable step-function opsins (SSFOs). Opsin delivery systems...opsin expression. Generally, the most robust and stable expression is achieved in a transgenic mouse line...
  9. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...plasmids optimized for use in AAV, or containing Staphylococcus aureus (SaCas9) . AAV is also a promising method...response, is non-pathogenic even in the wild-type state, and is thus thought to be the most suitable virus...quickly released through cell lysis. Episomal stability enables long-term transgene expression in non-...been well characterized and may be preferred over standard viruses for in vivo applications. Scientists have...divided between two transfer plasmids, but with substantial sequence overlap. Co-expression induces homologous...
  10. Guide to Using Pooled Libraries

    Type
    Guide
    ...CRISPR libraries include: resistance to the anti-cancer drug vemurafenib , resistance to Clostridium septicum... A well-designed screen can help you begin to understand what genes are important to a certain phenotype...septicum alpha-toxin , and resistance to to the nucleotide analog 6-thioguanine . Next-generation sequencing...
  11. Retrovirus Guide

    Type
    Guide
    ...This method utilizes a packaging cell line that stably expresses Gag-Pol and/or Env, eliminating the need...packaging cell line developed by Garry Nolan at Stanford contains Gag-Pol and either an ecotropic envelope...differentiated (non-dividing) cells. Both lentiviruses and standard γ-retroviruses use the Gag, Pol, and Env genes...provirus. 3' LTR in cis Terminates transcription started by 5' LTR by the addition of a poly A tract just...
  12. Cloning

    Type
    Guide
    ...dsDNA at a specified distance away from the recognition sequence. Cutting distal to their recognition ...This may be due to speed, cost, availability of starting materials or just personal preference. Check out... fragments you want to assemble before you get started. Check out Addgene's website for easy to use MoClo...
  13. Adenovirus Guide

    Type
    Guide
    ... adenoviral plasmid. One can also co-transform standard BJ5183 with supercoiled pAdEasy™ and the shuttle...information about AAV, read our AAV guide . Can I make a stable cell line with adenovirus? No, adenoviral vectors...with each round of amplification. What is RCA? RCA stands for r eplication c ompetent a denovirus. This may...
  14. Science Guides

    Type
    Guide
    ...Addgene has created the following guides to help you start learning about various scientific concepts related...control molecular signals and cells in order to understand their functions. Read More Pooled Libraries Pooled...
  15. Addgene's eBook Collection

    Type
    Guide
    ...When you're not sure where to start or need a handy reference, Addgene's eBooks are here to help!... eBook Collection When you're not sure where to start or need a handy reference, Addgene's eBooks are ...
  16. Chemogenetics Guide

    Type
    Guide
    ...they also retain the ability to be activated by standard optogenetics workflows (such as laser or LED illumination...Planning Your Chemogenetics Experiment If you're starting to plan your chemogenetics experiment, here are...
Showing: 1 - 16 of 16 results