...Educational Resources Molecular Biology Reference Molecular Biology Reference Jump To: Molecular Biology Basics...Addgene's molecular biology reference guide, including information on molecular genetics, plasmids, sequencing...verification Resources Genetic Code Webpage and Blog References Protocols Origins of Molecular Genetics The concept... Joshua Lederberg coined the term plasmid, in reference to any extrachromosomal heritable determinant....cells contain the same genetic information as the parental cell, and are thus termed clones of the original...molecular biologist’s toolbox. To learn more about different types of cloning methods check out our guide on...promoter (e.g., a liver-specific promoter). The strength of the promoter is also important for controlling...

...reduces photocurrent amplitude 490 ChR/T159C T159C mutation; displays increased photocurrents 470 SFO/...outside of the brain, rendering the experimental procedure less invasive. Different activation wavelengths...Introduction Microbial Opsins Optical Switches References Introduction The field of optogenetics integrates...naturally occurring microbial opsins that respond to different wavelengths of light, like blue or yellow light...light. These various opsins also initiate different electrochemical responses, such as nonspecific cation...optimization, and chimeric fusion of domains from two different ChRs. These ChR variants still function as light-gated...neuron. Feature enhancements include: Increased photocurrent amplitude Examples: ChR2(H134R), C1V1(t/t), ...

...Ligand(s) Effect Outcome (in neurons) Reference PSAM4 Gly Varenicline, uPSEM 792, uPSEM 817 Cl - influx Neuronal...RASSLs DREADDs PSAMs LMOs Planning Your Experiment References Chemogenetic tools are actuators for specific... of chemogenetic receptors. There are several different types of DREADDs that can be broadly classified...releases intracellular calcium stores. There are currently three Gq DREADDs based on human muscarinic receptors...cyclase and downstream cAMP production. There are currently two Gi DREADDs based on human muscarinic receptors...increasing intracellular cAMP concentrations. There is currently one Gs-DREADD, rM3D, that was created by replacing...intracellular region of a turkey erythrocyte β-adrenergic receptor with a rat M3 muscarinic receptor. This...

...heavy chain constant region” or Fc. Different isotypes play different roles in the immune response, and ...of colors activated by different wavelengths, allowing for easy differentiation between multiple antibodies...roughly fifty different fluorophore colors in flow cytometry, but the largest panels used currently are in the...Antibodies are typically produced in one of three different methods: in animals, in cultured immune cells,...contain two Fab fragments, each recognizing a different epitope, bound by short peptide linkers. Diabodies...used as an antimicrobial agent. Other chemical interferences with conjugating reactions are possible. It ...chemiluminescent reaction in the presence of several different substrates. The luminescence produced by the reaction...

...packaging; however, they are different viruses and thus use slightly different isoforms of these packaging...Generation 3rd Generation Viral Production FAQ References Glossary Lentiviral Components To increase the... contain an additional deletion in the 3'LTR, rendering the virus “self-inactivating” (SIN) after integration...packaging system. For a comparison of the key differences between the 2nd and 3rd generation packaging ...Questions (FAQ) about Lentiviral Plasmids What is the difference between 2nd generation and 3rd generation lentiviral... 3rd generation packaging system. What is the difference between a lentivirus and a retrovirus? Lentiviruses...retrovirus. From an experimental standpoint the main difference between lentiviruses and standard retroviruses...

...created using BioRender.com (Link opens in a new window) . Addgene Website & Blog References Website CRISPR..., A., Herreno-Pachón, A., Benincore-Flórez, E., Karunathilaka, A., & Tomatsu, S. (2024). Current strategies...Alternatives Resources Plan Your Experiment Web References PAM Sequences Glossary Publications CRISPR Overview...mutation within the targeted gene. However, the strength of the knockout phenotype for a given mutant cell... into high fidelity Cas9s (hfCas9) . There is currently no defined measure of fidelity, so sometimes they...pyrimidine-to-pyrimidine) Base transversions - edit to different classification of nucleotide base (purine-to-pyrimidine...genetic changes, including moving entire genes to different locations, by combining other gene editing mechanisms...

...pseudotype γ-retrovirus using different envelopes to modify tropism. Briefly, different envelope plasmids can ...packaging; however, they are different viruses and thus use slightly different isoforms of these packaging...from lentiviruses? There are a few important differences between engineered γ-retroviruses and lentiviruses...lentiviruses. First, these viruses were derived from different genomes (MoMLV and MSCV for γ-retrovirus; HIV ...be useful for the transduction of terminally differentiated (non-dividing) cells. Both lentiviruses and...generations of γ-retrovirus technologies? No, the different “generations” associated with lentiviral transfer... in gene therapy research to reduce promoter interference and/or drive high expression of a transgene ...

...2, and 5 display differential efficiency and cell tropism after delivery to different regions of the central...Integration Serotypes Pseudotyping AAV Variants References AAV Components The small (4.8 kb) ssDNA AAV genome...AAV for various gene delivery applications are currently underway. Return to Top Viral Integration As part...infect, making AAV a very useful system for preferentially transducing specific cell types. The chart ...pseudotyping, or the mixing of a capsid and genome from different viral serotypes. These serotypes are denoted using...experimented with hybrid capsids derived from multiple different serotypes, which also alter viral tropism. One...synthetic capsids and the mixing of capsids/ITRs from different AAV serotypes to create hybrid viruses with new...

...you to do many different molecular biology techniques (such as fusing it with different tags, putting ...Addgene's reference guide on molecular cloning techniques, including information on seven commonly used... Molecular Biology Reference Choosing a Molecular Cloning Technique Molecular Cloning...availability of starting materials or just personal preference. Check out our blog on choosing the right cloning...Gateway® destination plasmids have been made with different promoters, tags and fluorescent proteins. Thus... variety of promoters and into backbones with different selection cassettes). Although gateway cloning...base pairing in the annealed product, ligation is rendered unnecessary. The product may be transformed directly...

... Plasmid Reference Molecular Biology Reference Promoters Promoters Definition A promoter is...Addgene's molecular biology reference material covering promoters, transcription and the transcription...transcription of DNA into mRNA. Promoter binding is very different in bacteria compared to eukaryotes. In bacteria...promoter region. Each sigma factor recognizes different core promoter sequences. Operons Although bacterial...regulation, like operons. Operons are a cluster of different genes that are controlled by a single promoter... types of RNA polymerases that all transcribe different genes. RNA polymerase I transcribes genes encoding...

... Plasmid Reference Molecular Biology Reference Sequencing Primers Sequencing Primers...convenience. For reference information, please consult Addgene's Molecular Biology Reference Page . All listed...sequences listed on the left are provided for your reference. Addgene does not distribute primers. For sequencing... hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT...forward primer Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC...

...Desired Genetic Manipulation Different genetic manipulations require different CRISPR components. Selecting...experimental goal, you are ready to start navigating the different reagents that are available for your particular...targeting promoter elements of target gene Many different activators exist, including the multi-plasmid ...two mutated alleles, each mutated allele may be different owing to the error-prone nature of NHEJ. In HDR... is PCR amplified, PCR products are denatured-renatured, treated with a nuclease that cleaves DNA heteroduplexes...

...293 or 911; its deletion from the viral vector renders the virus replication incompetent. E3 is involved...Vogelstein designed multiple shuttle vectors for different purposes. The pAdTrack series contains an IRES-GFP...about Adenoviral Vectors Are adenovirus and AAV different? Yes! AAV is a small single-stranded DNA parvovirus...trans by 293 or 911 packaging cells; Its deletion renders the virus replication incompetent E3 Non-essential...

...Pooled libraries are single preparations of many different plasmids. Plasmids within a given library have...the same backbone, but they express or target different genes. Some libraries cover the majority of the...Find educational guides to learn more about the different types of viruses that are commonly used in research...

...pooled libraries are single preparations of many different plasmids. Plasmids within a given library have...the same backbone, but they express or target different genes. Some libraries cover the majority of the... library from the Moffat lab has over 175,000 different gRNA-containing plasmids). Amplifying and Using...

...you're not sure where to start or need a handy reference, Addgene's eBooks are here to help!...you're not sure where to start or need a handy reference, Addgene's eBooks are here to help! 0 of 0 Selected...