...transcription started by 5' LTR by the addition of a poly A tract just after the R sequence. Return to Top... a structural precursor protein, and Pol is a polymerase. Envelope gene (may be pseudotyped to alter infectivity...Integrase components. Transfer cPPT in cis Central polypurine tract; recognition site for proviral DNA synthesis...

...transcription started by 5' LTR by the addition of a poly A tract just after the R sequence. Return to Top...the LTR promoter. Transfer cPPT in cis Central polypurine tract; recognition site for proviral DNA synthesis...

...because they control the binding of RNA polymerase to DNA. RNA polymerase transcribes DNA to mRNA which is ultimately... factors in order for RNA polymerase II (a eukaryote-specific RNA polymerase) to bind to a promoter. Transcription...the RNA polymerase binding site, TATA box, and transcription start site (TSS). RNA polymerase will bind...binding of the RNA polymerase. A transcription complex is constructed from the RNA polymerase and several transcription...T7 RNA polymerase Promoter from T7 bacteriophage Sp6 Constitutive but requires Sp6 RNA polymerase Promoter...and trp Types of RNA Polymerases Promoters control the binding of RNA polymerase to DNA to initiate the...three types of RNA polymerases that all transcribe different genes. RNA polymerase I transcribes genes...

...and thymine (T). TOPO® cloning utilizes the Taq polymerase which naturally leaves a single adenosine (A)...Additionally, the efficiency can vary depending on the polymerase used, and the single A overhangs degrade over...common molecular biology enzymes: 5' exonuclease, polymerase and ligase. 5' exonuclease digests the 5' end...to generate 3' single-stranded overhangs. DNA polymerases synthesize DNA molecules using the 4 nucleotides...anneal to each other due to their homology. DNA polymerase then closes the gap created by the 5’ exonuclease...relies on the 3'-5' exonuclease activity of T4 DNA polymerase. An exonuclease is an enzyme which removes nucleotides... the end of a DNA strand. In LIC, the T4 DNA polymerase’s exonuclease activity creates “chewed-back” overhangs...

...vector, forward primer Polyhedrin forward AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer...primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For baculovirus vector with polyhedrin promoter...Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region, reverse primer CAT-R GCAACTGACTGAAATGCCTC... Reverse GTGGTTTGTCCAAACTCATC (Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...forward primer SV40pA-R GAAATTTGTGATGCTATTGC SV40 polyA, reverse primer SV40pro-F TATTTATGCAGAGGCCGAGG SV40...primer TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA, reverse primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial...

...lower background signals than polyclonal antibodies. However, polyclonal antibodies are more sensitive...clone that are specific to a certain epitope, or polyclonal, meaning there are many clones that are specific... antibodies are typically more expensive than polyclonal antibodies. Environmental factors, binding partners...available epitope on your protein of interest. Polyclonal antibodies are typically collected directly from...targeting various epitopes on the same antigen. Polyclonal antibodies are often more environmentally stable...protein in any form it may be present in. However, polyclonals can vary significantly from lot to lot, as immune...consider the following questions: Do you need polyclonal or monoclonal antibodies? Will you be using a...

...DNA polymerase adding nucleotides. The major difference in this process occurs when the polymerase incorporates.... During replication, DNA unwinds and the DNA polymerase enzyme binds to and migrates down the single ...replication requires the 4 nucleotides, a DNA polymerase enzyme, the template DNA to be copied, and a ... DNA and acts as a starting point for the DNA polymerase. Thus to replicate a piece of DNA in vitro one...

...159 (3), 647–661. PMID: 25307932 Hilton, I. B., D’Ippolito, A. M., Vockley, C. M., Thakore, P. I., Crawford...