...Back to Top Gateway® Recombination Cloning Gateway cloning (Image from Plasmid 101: Gateway Cloning ) Gateway... Gateway® cloning is a recombination based cloning method. The benefit of Gateway® is that moving a piece...cassettes). Although gateway cloning is a simple and efficient cloning method, gateway vectors and recombination...Guide Genome Engineering Guide Restriction Enzyme Gateway TOPO Gibson Type IIS Ligation Independent Cloning...fragment must first be amplified with specific Gateway attB1 and attB2 sites attached to the 5’ and 3’...sequence. This fragment can then be cloned into a gateway donor plasmid which contains compatible attP sites...it can be rapidly shuttled into any compatible Gateway® Destination vector, which contain attR sites via...

...restriction sites but compatible with the Gateway® cloning system? Gateway® compatible vectors use recombination...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB survival...Invitrogen's website for more information on the Gateway® cloning system. What safety concerns surround ...

...GCATGATGACCACCGATATG 3' end of Gateway cassette, forward primer GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette, reverse...

...fragment. Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. If you ...