Skip to main content
Addgene
Showing: 1 - 7 of 7 results

  1. Adenovirus Guide

    Type
    Guide
    ...because the early genes necessary for replication have been deleted from the shuttle vector. Early gene E1...erminal r epeats (ITRs). Genes are divided into early (E1-4) and late (L1-5) transcripts. There are 57...crossover event between your adenoviral vector and the early genes found in the packaging cell lines creates ...

  2. Sequencing Primers

    Type
    Guide
    ...CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT...CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT...primer pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward (pL) promoter, forward primer pLXSN 5' ...pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE), forward primer pMT2-F TTGCCTTTCTCTCCACAGGT...

  3. CRISPR Guide

    Type
    Guide
    ...Publications CRISPR Overview Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR...strand separation and cutting at off-target sites. Similarly, SpCas9-HF1 lowers off-target editing through ...target DNA based on the gRNA targeting sequence. Early experiments demonstrated that targeting dCas9 to...genetic screening. Forward genetic screens are particularly useful for studying diseases or phenotypes for...Cas12a (also known as Cpf1) CRISPR C lustered R egularly I nterspaced S hort P alindromic R epeat, a bacterial...2013. Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, Norville JE, Church GM. Science . 339(6121)...

  4. Chemogenetics Guide

    Type
    Guide
    ...Guide Jump To: Chemogenetics Guide Introduction Early Chemogenetic Receptors/RASSLs DREADDs DREADD ligands... over the cell population they are targeted to. Early Chemogenetic Receptors/RASSLs The first chemogenetic...

  5. Optogenetics Guide

    Type
    Guide
    ...and light oxygen voltage (LOV) domains function similarly to cryptochromes with light-induced changes in...Synthetic Neurobiology Group Optogenetics Resources Karl Deisseroth's Lab: Optogenetics Resource Center Boyden...

  6. Molecular Biology Reference

    Type
    Guide
    ...of phenotypic information was introduced in the early 19th century by Gregor Mendel, who later demonstrated...clones of the original cell. The plasmid DNA is similarly referred to as cloned DNA, and this process of...

  7. Science Guides

    Type
    Guide
    ...activity. Read More CRISPR Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR...
Showing: 1 - 7 of 7 results