...important for dosing in animal studies, made them attractive targets for development into chemogenetic tools...stimulating phospholipase C, which releases intracellular calcium stores. There are currently three Gq...and activate neuronal signaling by increasing intracellular cAMP concentrations. There is currently one ... was created by replacing the corresponding intracellular region of a turkey erythrocyte β-adrenergic ...the same back-metabolism issues as CNO and are attractive alternatives for experiments. Perlapine has been...used in human populations in Japan, making it an attractive option for translational studies, however, it...be an agonist against hM4Di, and is especially attractive for use in translational studies because it is...

...samples to extract proteins. Homogenize (tissues only), lyse, and then collect protein extract by centrifugation...and therefore should be kept at 4 °C. Record and track lot numbers for all antibodies used in the lab. ...application Process tissue or cell culture samples to extract proteins. Homogenize (tissues only) and lyse. Cross-link...In IHC, tissue sections are assayed and the extracellular matrix remains intact. The signaling molecule...enzyme. In ICC, cells have most or all of their extracellular matrix removed. Again, the signaling molecule...

...coined the term plasmid, in reference to any extrachromosomal heritable determinant. Plasmids are fragments...fragments can be inserted. When a plasmid exists extrachromosomally in E. coli , it is replicated independently...shaped bacteria naturally found in the intestinal tract of animals. There are many different naturally occurring.../mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg/mL Tetracycline 10 mg/mL 10 µg/mL *Note: Carbenicillin can be...

...multiple shuttle vectors for different purposes. The pAdTrack series contains an IRES-GFP construct that enables...transgene of interest. With these plasmids, one can track the infection of 293/911 cells throughout virus ...based vector Most common type of adenoviral vector pAdTrack Class of transfer vectors that contain IRES-GFP...

...Functional Screens New Tool for Lineage Tracing: The ClonTracer Library...that can be used for applications like lineage tracing or parsing the effects of expressing multiple genes...

...dynamic tracking of repetitive and non-repetitive genomic loci, chromosome painting, and RNA tracking in living...editing can specify a single mutation, even within a tract of identical bases. Browse Plasmids: Prime Edit ...proteins that target RNA instead of DNA enables tracking of RNA in live cells, including orthogonal RNA...synthetic fusion of the endogenous bacterial crRNA and tracrRNA that provides both targeting specificity and scaffolding...

...components. Transfer cPPT in cis Central polypurine tract; recognition site for proviral DNA synthesis. Increases...transcription started by 5' LTR by the addition of a poly A tract just after the R sequence. Return to Top...

...promoter. Transfer cPPT in cis Central polypurine tract; recognition site for proviral DNA synthesis. Increases...transcription started by 5' LTR by the addition of a poly A tract just after the R sequence. Return to Top...

...from phospholycerate kinase gene TRE Inducible Tetracycline response element promoter U6 Constitutive Human...

...molecular weight structures that are maintained extrachromosomally. rAAV are more likely than wild-type AAV ...

... primer Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene, reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA...