... it displays very high infectivity across a broad range of cell types. The mutant AAV-DJ8 displays the...transgene may be split between two AAV transfer plasmids, the first with a 3’ splice donor and the second...with a 5’ splice acceptor. When these viruses co-infect a cell they form concatemers, are spliced together...hybrid capsid derived from eight serotypes. AAV-DJ displays a higher transduction efficiency in vitro than... with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell tropism after ... . Expanding AAV packaging capacity with trans-splicing or overlapping vectors: a quantitative comparison...

... Rev Response Element (RRE) within unspliced and partially spliced transcripts to facilitate nuclear export...the components necessary for virus production are split across multiple plasmids (3 for 2nd-generation systems... a few key ways. First, the packaging system is split into two plasmids: one encoding Rev and one encoding...

...promoter/origin, forward primer SV40-spliceR CACAAAGATCCGGACCAAAG SV40 splice sequence, reverse primer T3 GCAATTAACCCTCACTAAAGG...vector, forward primer SFFV-F ATTGATTGACTGCCCACCTC Spleen focus forming virus 5' LTR, forward primer SP6 ...

... reverse transcription. The edited DNA strand displaces the unedited 5’ flap, and the resulting heteroduplex...including editors based on a second ADAR variant that displays improved specificity, and editors carrying an ... in vivo RNA imaging or to control alternative splicing. Figure 13: Overview of RNA targeting (A) and ...locus-specific targeting of long RNAs with CRISPR-Display. Nature Methods , 12 (7), 664–670. PMID: 26030444...

...should be made HDR requires a repair template and displays reduced efficiency compared to NHEJ knockout. ...region is removed from the mRNA due to alternative splicing. Exons near the N-terminus are targeted since ...

... (dsDNA) molecule containing multiple, heavily spliced transcripts. At either end of the genome are i ...

...photocurrent amplitude 490 ChR/T159C T159C mutation; displays increased photocurrents 470 SFO/SSFO Step function...