...promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT 3' end of IRES, forward primer IRES-R CCTCACATTGCCAAAAGACG...CCTCACATTGCCAAAAGACG 5' end of IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector...

...different purposes. The pAdTrack series contains an IRES-GFP construct that enables co-expression of GFP ... pAdTrack Class of transfer vectors that contain IRES-GFP pShuttle Class of transfer vectors that do not...DNA viruses. They are not related; however, AAV requires the presence of adenoviral genes E1, E4, E2a and...

...28774929 Guettier JM, Gautam D, Scarselli M, de Azua IR, Li JH, et al (2009). A chemical-genetic approach...

...Constitutive but requires T7 RNA polymerase Promoter from T7 bacteriophage Sp6 Constitutive but requires Sp6 RNA...eukaryotes. In bacteria, the core RNA polymerase requires an associated sigma factor for promoter recognition...

...transcription of shRNAs. cDNA expression requires RNA pol II, and thus requires an RNA pol II promoter, such as...driven by the 5'LTR, which is a weak promoter and requires the presence of Tat to activate expression. The...

...indel formation compared to HDR. Prime editing requires more optimization and typically has lower efficiency...living cells. Visualizing a specific genomic locus requires recruitment of many copies of labeled proteins...gRNAs that tile the locus. Chromosome painting requires delivery of hundreds of gRNAs with target sites...

... regions of interest. In vitro DNA replication requires the 4 nucleotides, a DNA polymerase enzyme, the...tagged base is incorporated. Sanger sequencing requires a lot of DNA because the ultimate goal is to have...

...cytometry requires a negative control, a small subset of the sample with no antibodies. It also requires single-antibody...

...supplied in trans . In addition to Rep and Cap, AAV requires a helper plasmid containing genes from adenovirus...

...targeting the region where the edit should be made HDR requires a repair template and displays reduced efficiency...