...prior to use in an experiment. E. coli strains for propagating plasmids E. coli are gram-negative, rod ...Addgene blog posts relating to common E. coli lab strains and E. coli strains specialized for protein ...BL21 Invitrogen; New England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA...Engineering Plasmids Reporter Plasmids Viral Plasmids E. coli strains for propagating plasmids Antibiotics...genes. For instance, most plasmids are replicated in E. coli and are relatively small (∼3000 - 6000 basepairs...inserted. When a plasmid exists extrachromosomally in E. coli , it is replicated independently and segregated...are many different naturally occurring strains of E. coli , some of which are deadly to humans. The majority...

...increase its specificity. 2018. Lee JK, Jeong E, Lee J, Jung M, Shin E, Kim YH, Lee K, Jung I, Kim D, Kim S, ...screens in E. coli identify essential genes and phage host factors. 2018. Rousset F, Cui L, Siouve E, Becavin...specificity and lower off-target activity. By screening E. coli cells transformed with a pooled library of SpCas9...transduce cells with the lentiviral library (panel E ). Remember - if you are using a 2-vector system, ...creating premature stop codons NHEJ N on- H omologous E nd J oining; A DNA repair mechanism that often introduces...Khedher AHY, Menoret S, Brion A, Lamribet K, Dardillac E, Boix C, Perrouault L, Tesson L, Geny S, De Cian A...of CRISPR-Cas9. 2017. Harrington LB, Doxzen KW, Ma E, Liu JJ, Knott GJ, Edraki A, Garcia B, Amrani N, Chen...

...transformed into AdEasier-1 cells , which are BJ5183 E. coli cells containing pAdEasy™. pAdEasy™ is a ∼33Kb...Useful for very large inserts AdEasier-1 cells BJ5183 E. coli cells containing the pAdEasy-1 packaging plasmid...renders the virus replication incompetent. E3 is involved in evading host immunity and is not essential ... replication incompetent E3 Non-essential gene involved in immune evasion, deleted to increase packaging...cell line Transfer Vocabulary Term Definition ITR Inverted terminal repeat; Contains elements that promote...

... pBAD Forward ATGCCATAGCATTTTTATCC (Invitrogen) For vectors with E. coli araBAD promoter, forward primer...primer pBAD Reverse GATTTAATCTGTATCAGG (Invitrogen) For vectors with E. coli araBAD promoter, reverse primer...CCCAGTCACGACGTTGTAAAACG (Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene...AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward ...Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse...reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward...

...them less than ideal. DREADDs D esigner R eceptors E xclusively A ctivated by D esigner D rugs (DREADDs...small molecules termed P harmacologically S elective E ffector M olecules (PSEMs). PSAM domains were first...receptors. J. Biol. Chem. 266:5–8. PMID: 1670767 Vardy E, Robinson JE, Li C, Olsen RHJ, DiBerto JF, et al (...downstream signalling. GPCRs have been shown to be involved in a wide variety of biological processes, including...

...operon trp Repressible by tryptophan Promoter from E. coli tryptophan operon Ptac Regulated like the lac...operator preventing transcription. The trp operon involved in the production of tryptophan is an example ...

...Optogenetics Resource Center Boyden ES, Zhang F, Bamberg E, Nagel G, Deisseroth K. 2005. Millisecond-timescale...brain, rendering the experimental procedure less invasive. Different activation wavelengths also make it...Henninger MA, Kodandaramaiah SB, et al. 2014. Noninvasive optical inhibition with a red-shifted microbial...