... Commonly Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter...resistance gene, reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter...forward primer pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC...AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward primer Luc-F AGTCAAGTAACAACCGCGA...MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE), forward primer...

...fused to a heterologous enhancer/promoter such as CMV or RSV Return to Top Viral Production The process...and thus requires an RNA pol II promoter, such as CMV or RSV. What techniques can be used to clone an insert...hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription started...

...Used in Research Promoter Expression Description CMV Constitutive Strong mammalian promoter from human...

... vector Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter...