...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...promoter, forward primer Alpha-factor TACTATTGCCAGCATTGCTGC (Invitrogen) Alpha factor signal sequence, ...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...CCATCTAATTCAACAAGAATTGGGACAAC (Ahmad lab) 5' end of GFP, reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae...reverse primer XEF1a TTTCGCCCTAACTTCGTGAT Xenopus EF1 alpha enhancer/promoter, forward primer Xpress Forward...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP...

...typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive cells, or selection...transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify and enrich positive... Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically...

...contain a reporter gene (for example, luciferase or GFP) that offers a read-out of the activity of the genetic... common lab strains MG1655 and its derivatives DH5alpha and DH10b (also known as TOP10) among others, ...lacY1 proA2 rpsL20(StrR) xyl5 lambda- leu mtl1 DH5alpha Invitrogen F- Phi80lacZDeltaM15 Delta(lacZYA-argF...