Skip to main content
Addgene
Showing: 1 - 10 of 10 results
  1. CRISPR Guide

    Type
    Guide
    ...23287722 Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A., Saunders, S. J., Barrangou,...Ishiguro, S., Gao, L., Hirano, S., Okazaki, S., Noda, T., Abudayyeh, O. O., Gootenberg, J. S., Mori, H...Chandrasekaran, S. S., Perry, N. T., Schaepe, J., Du, P. P., Lotfy, P., Bassik, M. C., Bintu, L., Bhatt, A. S., & ...PMID: 38216671 Klompe, S. E., Vo, P. L. H., Halpin-Healy, T. S., & Sternberg, S. H. (2019). Transposon-encoded...Scheiman, J., Vora, S., Pruitt, B. W., Tuttle, M., Iyer, E. P. R., Lin, S., Kiani, S., Guzman, C. D., Wiegand..., E. C., Newberry, K. M., Smith, S. B., Meadows, S. K., Roberts, B. S., Mackiewicz, M., Mendenhall, E....Gootenberg, J. S., Abudayyeh, O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung...
  2. Sequencing Primers

    Type
    Guide
    ...Invitrogen) S. cerevisiae GAL1 promoter, forward primer Gal10pro-F GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae... 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer SP6 ATTTAGGTGACACTATAG... reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter, forward primer GW-3' GCATGATGACCACCGATATG...promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer OpIE2 Forward... 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer pGP704-R AACAAGCCAGGGATGTAACG...
  3. Plan Your Experiment

    Type
    Guide
    ...endogenous gene(s) without permanently modifying the genome dCas9-activator (such as dCas9-VP64) gRNA(s) targeting... (CRISPRi) Reduce expression of a particular gene(s) without permanently modifying the genome dCas9-repressor...repressor (such as dCas9-KRAB) or dCas9 gRNA(s) targeting promoter elements of target gene dCas9-KRAB ...
  4. Chemogenetics Guide

    Type
    Guide
    ... JC, Snowball A, Knauss S, von Schimmelmann M, During MJ, Lignani G, Schorge S, Young D, Kullmann DM, ...their activity in neurons PSAM Ion Pore Domain Ligand(s) Effect Outcome (in neurons) Reference PSAM4 Gly Varenicline... window) Armbruster BN, Li X, Pausch MH, Herlitze S, Roth BL (2007). Evolving the lock to fit the key ...Haberman A, Graham J, Block J, Zhou W, Chen Y, Zhang S-C (2021). Human Stem Cell-Derived Neurons Repair Circuits...
  5. Molecular Biology Reference

    Type
    Guide
    ...plasmid. Additionally, the restriction enzyme site(s) allow for the cloning of a fragment of DNA to be ...information and a more extensive strain list. Strain Vendor(s) Genotype BL21 Invitrogen; New England BioLabs E. ...datasheet or the plasmid map to confirm which antibiotic(s) to add to your LB media or LB agar plates. Antibiotic..., or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino Acids ..., UUC Proline Pro P CCU, CCC, CCA, CCG Serine Ser S UCU, UCC, UCA, UCG, AGU,AGC Threonine Thr T ACU, ACC...SV40 NLS PKKKRKV or PKKKRKVG Protein C EDQVDPRLIDGK S Tag KETAAAKFERQHMDS SB1 PRPSNKRLQQ Webpage and Blog...
  6. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...of AAV serotypes, indicating the optimal serotype(s) for transduction of a given organ. Tissue Optimal... OS, Velardo MJ, Peden CS, Williams P, Zolotukhin S, Reier PJ, Mandel RJ, Muzyczka N. Mol. Ther. 2004 ...
  7. Lentiviral Guide

    Type
    Guide
    ...self-inactivating” (SIN) after integration. Packaging plasmid(s) Envelope plasmid Addgene’s packaging and envelope...one transfer plasmid one or two packaging plasmid(s) one envelope plasmid After media change and a brief... Retroviral integration site selection. Desfarges S, Ciuffi A. Viruses. 2010. Jan;2(1):111-30. PubMed ...
  8. Science Guides

    Type
    Guide
    ...CRISPR Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR) systems, which ...
  9. Retrovirus Guide

    Type
    Guide
    ...the wild type L TR, an MCS for cloning X gene, an S V40 promoter, and N eomycin selection. Return to Top...
  10. Antibody Guide

    Type
    Guide
    ...slotted in a specific direction based on the emission(s) read by the machine. Controls for cell sorting methods...
Showing: 1 - 10 of 10 results