...Table 4 ). Design Deletion Screening Primers Design one set of primers internal to the sequence to be deleted...promoter forward primer: CGTAACTTGAAAGTATTTCGATTTCTTGGC. This is a representative sequencing primer; other flanking...10 μl 2x PCR mix, 0.5 μl forward primer (10 μM), 0.5 μl reverse primer (10 μM), 50-100 ng gDNA, and H 2...deleted (“non-deletion band”) and another set of primers upstream and downstream of the sgRNA cleavage sites...too large to efficiently amplify. Typically use primers at least 100 bp from the predicted cleavage site...indel at the sgRNA target site. Design additional primers to analyze for scarring (small indels produced ...intended deletion). Use a pair of forward and reverse primers flanking each sgRNA target site (within 150 - 350...

...sequences for each (these can be built into PCR primers when creating a new part, with an additional 5'...suffix will need to be reverse complimented for primer design. The restriction enzymes used for assembly...

...genomic DNA locus. The longer pegRNA also encodes a primer binding site (PBS) and the desired edits on a RT...and generates a 3’ flap. The 3’ flap binds to the primer binding site (PBS) of the pegRNA and the desired...

...are titered by droplet digital PCR (ddPCR) using primers and probes targeting the ITR elements and an internal...incubated for 72 h, and genomic DNA is extracted. Primers and probes targeting integrated copies of the lentiviral...

..., but couldn't amplify the EMX1 gene using same primer you used in the Science paper ( Cong et al. , Science...publication of our paper, we have two new optimized primers that may work better than the published ones, so...reaction still does NOT work, you can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse...

...by homology to a genomic DNA locus and encodes a primer binding site and the desired edits on an RT template...

...residual plasmid is extracted and amplified with primers targeting the heavy chain and/or light chain variable...

...by homology to a genomic DNA locus and encodes a primer binding site and the desired edits on an RT template...

...by homology to a genomic DNA locus and encodes a primer binding site and the desired edits on an RT template...

...by homology to a genomic DNA locus and encodes a primer binding site and the desired edits on an RT template...

...design (10 different prediction scores), clone (primer design), and evaluate gRNAs, as well as predict...

... region of interest can be PCR amplified using primers that (A) flank the region of interest (deletions...

...flap. However, the longer pegRNA also encodes a primer binding site (PBS) and the desired edits on a RT...gRNA; a specialized gRNA containing an additional primer binding site and reverse transcription template...