Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 13 of 13 results

  2. CRISPR Plasmids - Plants

    Type
    Collection
    ... Hygro Yang pKSE401 AtU6-26 yes, cut S. pyogenes Kan Chen pRGE31 rice snoRNA U3 BsaI none S. pyogenes ...

  3. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Clover - Mammalian Expression pFA6a-link-yoClover-Kan - Yeast Expression dClover2 505 515 Dimer (A206K)...C1 - Mammalian Expression pFA6a-link-yoTagRFP657-Kan - Yeast Expression smURFP + BV 642 670 32 39 min ...Bacterial Expression tandem PA-GFP-KanR - Yeast Expression pFA6a-PA-GFP-kanMX6 - Yeast Expression pFA6a-link-yEPAGFP-CaUra3...

  4. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Basta Chen pKSE401 62202 Plant yes, cut S. pyogenes Kan Chen pHUE411 62203 Plant yes, cut S. pyogenes Hyg...Jackson pMZ376 74213 Yeast rrk1 yes, cut S. pyogenes KanMX Zaratiegui pMZ377 74214 Yeast rrk1 yes, cut S. pyogenes...

  5. Cre-lox system

    Type
    Collection
    ...Cre rTH AAV Wilson 108454 mCherry-p2A-CreERT2-FRT-kan-FRT For in vitro transcription of Cre or to recombine...; Targeting vector for Sox1 locus CAG Mammalian Okano 153207 pAM-AAV-mSncg-Cre Retinal ganglion cell-specific...

  6. Structural Genomics Consortium Plasmids

    Type
    Collection
    ...cleavage, KanR 26101 pET28GST-LIC EF456739 GST-tag and hexahistidine tag with Thrombin cleavage, KanR 26096...cleavage, KanR 26105 pNIC-CTHF EF199844 Hexahistidine tag, FLAG tag with TEV cleavage, KanR 26106 pNH-...MHL EF456735 Hexahistidine tag with TEV cleavage, KanR 26098 pCW-LIC EF460848 No tag, double ptac promoter...Hexahistidine tag, thioredoxin with TEV cleavage, KanR 26107 pNIC-ZB GU452710 Hexahistidine tag , Z-basic...

  7. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...AAV.cc81 Cap Asokan 199746 pAAV.cc84-mut AAV.cc84 Expresses AAV2 Rep and AAV.cc84 Cap Asokan 200257 pArk313...203532 iCAP-BI-28-KanR AAV-BI28 RepCap for AAV production Deverman 203533 iCAP-BI-48-KanR AAV-BI48 RepCap...203534 iCAP-BI-49-KanR AAV-BI49 RepCap for AAV production Deverman 203535 iCAP-BI-62-KanR AAV-BI62 RepCap...RepCap for AAV production Deverman 203536 iCAP-BI-65-KanR AAV-BI65 RepCap for AAV production Deverman 205991...

  8. CRISPR Plasmids - Tagging

    Type
    Collection
    ... CRISPR/Cas Toolkit Kanemaki Lab Auxin-Inducible Degron Tagging Masato Kanemaki's lab has developed a ...

  9. Validated gRNA Sequences

    Type
    Collection
    ...TATTAAATGCAGATAACCT 66089 cut S. pyogenes 25249454 Seydoux KANK3 H. sapiens GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes...GGGGCCACTAGGGACAGGAT 72833 cut S. pyogenes 27052166 Kanemaki mmp21 D. rerio CGGAGCTGATCACTGACA 72890 cut S....

  10. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...PAM = NGG) pCRISPR BsaI E. coli, S. pneumoniae Kanamycin none, need Cas9 plasmid Marraffini pCas9 BsaI ...

  12. Rett Syndrome

    Type
    Collection
    ... (Link opens in a new window) PMID: 6638958 Kankirawatana et al. 2006. Early progressive encephalopathy...

  13. Deisseroth INTRSECT Collection

    Type
    Collection
    ...AC, Tepler S, Poulin JF, Ansorge M, Awatramani R, Kang UJ, Rayport S. 2018. Dopamine neuron glutamate cotransmission...
Showing: 1 - 13 of 13 results