Skip to main content
Addgene
Showing: 41 - 60 of 84 results

  1. Plan Your Experiment

    Type
    Collection
    ... Science Guides CRISPR Guide Plan Your Experiment Plan Your CRISPR Experiment Jump To: Plan Your Experiment...you started using CRISPR in your research. Although we will use the example of CRISPR/Cas9 in mammalian...express the CRISPR machinery. For more difficult cells (e.g. primary cells), viral delivery of CRISPR reagents...conducting genome-wide screens using CRISPR AAV transduction CRISPR elements are inserted into an AAV transfer...lipids Transient expression of CRISPR components Short window of CRISPR activity may decrease off-target...Expression System Design gRNA Publications Get Started CRISPR is a powerful system that enables researchers to... cells, many of these principles apply to using CRISPR in other organisms. First, consider the genetic...

  2. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ... CRISPR References & Information Genomic Deletions in Mammalian Cell Lines CRISPR: Protocol...Mammalian Cell Lines Other Addgene Resources CRISPR Plasmids CRISPR Guide Addgene Blog Posts Addgene is proud...regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed.... Perform maxi-prep for each CRISPR/Cas9 construct. Transfecting CRISPRs into Cells of Interest NOTE: ...using CRISPR/Cas9 CRISPR...Orkin's and Daniel Bauer's labs details the use of CRISPR/Cas9 to create genomic deletions in mammalian cell...of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9. Bauer DE, Canver MC, Orkin SH. J. Vis. Exp...

  3. Worm Expression Resources

    Type
    Collection
    ... individually. CRISPR Read Addgene's CRISPR Guide for a general introduction to CRISPR technology. Addgene's... tag insertion using CRISPR/Cas9 and the selection of C. elegans strains. CRISPR plasmids from John Calarco's...genome editing in C. elegans via a CRISPR-Cas9 system. Cloning-free CRISPR for C. elegans , which uses purified...Browse plasmid tools, kits, and resources (such as CRISPR and synthetic biology collections) for use in C... feeding worms bacteria expressing dsRNA or use CRISPR/Cas9 gene editing to easily engineer specific transgenic...contain tools for use in worm research. This includes CRISPR, RNAi, empty backbones, fluorescent proteins, and...Addgene's worm CRISPR resources include plasmids expressing Cas9, empty gRNA backbones, and constructs ...

  4. Zebrafish Plasmid Collection

    Type
    Collection
    ...Collection CRISPR Please refer to Addgene's CRISPR Guide for a general introduction to CRISPR technology...examples of useful zebrafish CRISPR resources can be found below: UFlip CRISPR targeted integration vectors...for Targeted Integration Using CRISPR/Cas9 - Jeffrey Essner Lab CRISPR-Cas/RNA-Guided Nuclease (RGN) expression...Joung Lab CRISPR/Cas9-based conditional mutagenesis in zebrafish - Wenbiao Chen Lab A CRISPR/Cas9 Vector...modified CRISPR-Cas9 system - Shuo Lin Lab Re-purposed Ac/Ds transgenic system enabling CRISPR/dCas9-interference...for the laboratory use of zebrafish. CRISPRz - A database of CRISPR/Cas9 target sequences that have been...morpholinos, zinc finger nucleases, TALENS, and CRISPR/Cas9-based gene editing make the zebrafish a stalwart...

  5. Plant Plasmids and Resources

    Type
    Collection
    ... Addgene! CRISPR Please refer to Addgene's CRISPR Guide for a general introduction to CRISPR technology...like... Plant CRISPR resources Fluorescent Protein Guide Addgene Blog: Plant Biology CRISPR Cloning Transcription...Rice - Yinong Yang. The MoClo CRISPR/Cas Toolkit for Plants includes CRISPR/Cas nucleases, base editors,...technology or the Plant CRISPR Resources for a full selection of plasmids expressing different functional variants... gRNA backbones. A few examples of useful plant CRISPR resources include: A Multipurpose Toolkit enables...truncatula , wheat, and barley - Daniel Voytas. A CRISPR/Cas9 Toolkit for use in a variety of plant species...series of vectors and DNA modules for assembly of CRISPR/Cas9 constructs - Sylvestre Marillonnet and Johannes...

  6. Microbiology Resources

    Type
    Collection
    ...Microbiology General CRISPR Resources Read our CRISPR Guide for a general introduction to CRISPR technology. Check...software. Addgene yeast CRISPR resources Bacterial CRISPR Resources The CRISPR technology was developed...synthetic biology. CRISPR Resources : Find essential background information on using CRISPR in your lab, specific... Check out our CRISPR reference page for CRISPR resources, such as depositor protocols and gRNA design...Find CRISPR tools for use in genome editing of bacteria. CRISPathBrick Multiplex Plasmid : CRISPR expression... specific CRISPR tools for genome editing in bacteria, and more. Synthetic Biology : Browse our deposited...editing is not always straightforward. Read our CRISPR Methods for Bacterial Genome Engineering blog post...

  7. Lentiviral Prep Service

    Type
    Collection
    ...Packaging Service page . Pooled CRISPR Libraries for Screening Use pooled CRISPR libraries to screen for genes...gRNA pooled library in lentiCRISPRv2 Human sgRNA library in backbone lentiCRISPRv2 targeting 19,114 genes...92379 Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A Human CRISPRa sgRNA activation...libraries 92385 Human CRISPR inhibition library Dolcetto in XPR_050 (VP64) Set A Human CRISPR inhibition library...Root 92386 Human CRISPR inhibition library Dolcetto in XPR_050 (VP64) Set B Human CRISPR inhibition library...genes. For more information on CRISPR plasmids and function, see our CRISPR plasmids resource page . Cas9...Service Lentivirus Browse In-Stock Lentivirus Pooled CRISPR Libraries Cas9 Pooled Barcoding Libraries Control...

  8. Ras Pathway

    Type
    Collection
    ...factor SPRED SPRED1 SPRED2 SPRED3 Sprouty related, EVH1 domain containing SPRY SPRY1 SPRY2 SPRY3 SPRY4 ...SPRY4 Sprouty RTK signaling antagonist STK STK3 STK4 Serine/threonine kinase STK11 Serine/threonine kinase...

  9. Validated gRNA Sequences

    Type
    Collection
    ...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below...PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments... Genome Engineering CRISPR Validated gRNA Sequence Datatable Validated gRNA...that have been experimentally validated for use in CRISPR experiments. This datatable is compiled from plasmids...experiments use targeting sequences within exons, whereas CRISPR activation or repression experiments use targets...possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate...Church GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn gp78 H. sapiens...

  10. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...Anti-CASPR/Neurexin IV [K65A/2R] CASPR/Neurexin IV Mouse IgG2a 206606 Anti-CASPR2 [K67/11R] CASPR2 Human...177445 Anti-CASPR/Neurexin IV [K65/35R] CASPR/Neurexin IV Rat Mouse IgG2a 177446 Anti-CASPR2 [K67/25R] ...219448 Anti-CASPR/Neurexin IV [K65A/30R] CASPR/Neurexin IV Rat Mouse IgG2a 219449 Anti-CASPR/Neurexin IV...SAP97 Rat Mouse IgG2a 128625 Anti-CASPR/Neurexin IV [K66/38R] CASPR/Neurexin IV Rat Mouse IgG2a 128626...VAPA Rat Mouse IgG2a 199403 Anti-CASPR/Neurexin IV [K65/35R-2b] CASPR/Neurexin IV Rat Mouse IgG2b 199404...external) Human Mouse IgG1 206683 Anti-CASPR/Neurexin IV [K65/35R-1] CASPR/Neurexin IV Rat Mouse IgG1 206684...K28/77R] PSD-95 Human Mouse IgG2a 220381 Caspr [K65/31R] Caspr Rat Mouse IgG2a 220382 KChIP3 K+ channel...

  11. COVID-19 Resources

    Type
    Collection
    ...Lab Cas12a plasmids Addgene's full CRISPR guide and summary of CRISPR pooled libraries . FlipGFP-based ...coronavirus - Enabling coronavirus detection using CRISPR-Cas13: Open-access SHERLOCK research protocols ...develop the method termed DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR). Mammoth Biosciences has... of the 2019 novel coronavirus SARS-CoV-2 using CRISPR diagnostics: SARS-CoV-2 DETECTR (Link opens in ...now available from Ray Owens' lab. Development of CRISPR as an Antiviral Strategy to Combat SARS-CoV-2 and...181(4):865-876.e12. (Link opens in a new window) CRISPR tools and reporters now available from Stanley ...Collection Science Journals Coronavirus Collection Springer Nature SARS-CoV-2 and COVID-19 Articles Wiley ...

  12. Rett Syndrome

    Type
    Collection
    ...Addgene's CRISPR Guide for a general introduction to CRISPR technology or the mammalian CRISPR resources...'s Plasmids for Stem Cell Research page. CRISPR Tools CRISPR technology is a promising therapeutic approach...examples of additional CRISPR resources can be found below: Base Editing RNA Editing CRISPR-based DNA methylation...Resource Center MECP2 Animal Models Human Cell Lines CRISPR Tools Plasmids Resources The (Link opens in a new...

  13. AAV for Neuronal Tracing

    Type
    Collection
    ...but new virus cannot spread to any neighboring cells. To enable monosynaptic spread of this deletion-mutant...the virus can spread from this cell to synaptically connected cells (meaning, it can spread to cells that...infected cells, but is required for transynnaptic spread (Wickersham et al., 2007a, Wickersham et al., 2007b...through complementation, G-deleted rabies virus can spread to monosynaptically connected cells. To further...

  14. Bacterial Expression Systems

    Type
    Collection
    ...list of our bacterial CRISPR plasmids, see here . pwtCas9-bacteria 44250 CRISPR Stanley Qi Anhydrotetracycline... list of our bacterial CRISPR plasmids, see here . pgRNA-bacteria 44251 CRISPR Stanley Qi Expression of...alter bacterial genomes. From recombineering to CRISPR , this collection contains a variety of tools to...research. Plasmid ID Technique PI Purpose pCas9 42876 CRISPR Luciano Marraffini Bacterial expression of Cas9... For a more comprehensive list of our bacterial CRISPR plasmids, see here . pGRG Series Various Plasmids...

  15. Neurodegeneration Research Collection

    Type
    Collection
    ...Dhekne et al. Elife. 2023 Oct 24. See More CRISPR Tools Find CRISPR pooled libraries available from Addgene...neurodegeneration research. Disease Info Plasmid Collection CRISPR Tools AAV Viral Preps iPSC Differentiation Factors...about the blood brain barrier integrity, and using CRISPR screens to understand more globally how neurons...plasmid pooled libraries . New and Noteworthy: Use a CRISPRi system to target alpha-synuclein. Sastre et al..... Target neural oxytocin receptors using an AAV-CRISPR/Cas9 strategy for gene editing across divergent...

  16. Resolute Plasmid Collection

    Type
    Collection
    ...Plasmid Gene/Insert Industry PI Pooled Libraries CRISPR and overexpression pooled libraries are useful ...Human SLC Activation Library 132561 Superti-Furga CRISPR activation library targeting human SLC proteins...Human SLC Knockout Library 132552 Superti-Furga CRISPR knockout library targeting human SLC proteins. ...Mouse SLC Knockout Library 141436 Superti-Furga CRISPR knockout library targeting mouse SLC proteins. ...Knockout Libraries 213695 221409 221410 Superti-Furga CRISPR knockout library targeting human transmembrane ...

  17. Plasmids for Stem Cell Research

    Type
    Collection
    ...mitosis. Nat Commun. 2016 Mar 7;7:10869. Hu CRISPRa Human CRISPR activator system for reprogramming human...Retinal Ganglion Cells AAV/CRISPR Mouse Glia-to-Neuron Conversion by CRISPR-CasRx Alleviates Symptoms ...enogenous genes Human pluripotent reprogramming with CRISPR activators. Nat Commun. 2018 Jul 6;9(1):2643. Otonkoski... Brennand iPSCs Cortical or Lower Motor Neurons CRISPR/TALEN Human Transcription Factor-Mediated Differentiation...

  18. Plasmid Collections

    Type
    Collection
    ...plasmids, kits, and pooled libraries. Find tools for CRISPR, fluorescent proteins, optogenetics, biosensors... Genome Engineering Genome Engineering Overview CRISPR Cre-lox TALENs Zinc Fingers Luminescence Fluorescent...pooled libraries. Pooled Library Types cDNA shRNA CRISPR gRNAs Depositor Collections A modular set of plasmids...view all collections. Depositor Collection Types CRISPR Fluorescent Proteins Protein Expression Synthetic...

  19. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ...subretinal administration and enhanced transduction and spread following injection in the brain. The AAV2(4pMut...displays highly efficient transduction and lateral spread in the retina following subretinal injection. It...serotype has increased transduction and lateral spread in the retina following subretinal injection as...AAV Capsids Improve Transduction and Volumetric Spread in the CNS. Mol Ther Nucleic Acids . Sep 15;8:184...

  20. Depositor Collections

    Type
    Collection
    ...Trimmer Lab Recombinant mAb Plasmid Collection CRISPR CRISPR-on: an RNA-guided transcriptional activator ...Browse depositor collections of antibody, CRISPR, disease research, visualization, protein expression...
Showing: 41 - 60 of 84 results