...recommended applications. The specific QC experiments performed varies for each antibody catalog item. Whenever...specific antibody can be found on the antibody's catalog page or by contacting [email protected] . Some of...Innovation (IPI). For these antibodies, IPI will be indicated as the Depositing Lab on the antibody webpage....cells and will interfere with conjugation. For applications such as these, the buffer can be removed by ...aliquots before storing at -20 °C. Each antibody catalog item is tested for shipping stability by incubating...

...antibodies are produced in-house and undergo application-specific validation and quality control by Addgene...extensively validated for neuroscience research applications from the NeuroMab/Trimmer Lab Recombinant mAb...imaging. Learn more about antibodies and their applications in our Antibody Guide ! Cloning and Expressing...antibodies, and Fc-silent mutants. Functional diversification of hybridoma-produced antibodies by CRISPR/...456(1):527-33. Gavin Wright pET-30-based vector dedicated to efficient scFv expression, which circumvents...and Generation of synthetic nanobodies against delicate proteins. Nat Protoc. 2020 Apr 8. Markus Seeger...

...cell and regulates the switch from anabolic to catabolic processes. Active mTORC1 promotes protein and ...energy-intensive processes. mTORC1 also blocks catabolic processes including autophagy and lysosome biogenesis... below. Color is used for clarity and does not indicate a specific relationship. The content for this ...Pathway Color is used for clarity and does not indicate a specific relationship. The content for this ...Pyruvate dehydrogenase kinase, isozyme 1 PI3K Catalytic Subunits PIK3CA PIK3CB PIK3CD PIK3CG Regulatory...Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic and regulatory subunits - Class I PKC PKC alpha...

... nuclease along with the guide RNA. For most applications, we recommend using Cas9 with the single guide...BbsI, and a pair of annealed oligos (design is indicated below) can be cloned scarlessly into the vector...BbsI, and a pair of annealed oligos (design is indicated below) can be cloned into the CRISPR array. The...61592 : PX600; CMV-driven SaCas9 60957 : PX551; Truncated MeCP2 promoter-driven SpCas9; for neuronal expression...expressing human codon-optimized SpCas9, driven by the truncated MeCP2 promoter (pAAV-pMecp2-SpCas9-spA) for expressing...function of genetic elements. To broadly enable the application of Cas9 in vivo and ex vivo , the Zhang Lab established...can be combined with Cas9 in a wide range of applications. Full references are below. The Cas9 knockin...

...the most abundant forms of posttranslational modifications in cells and research into its many roles in...Importantly, phosphorylation positional isomers are allocated to different subpools, allowing precise knowledge...-EFSep) Plasmid 34624 SepOTSα tRNA-Sep ( aka. pCAT112TAG-SepT) Plasmid 68283 SepOTSβ Plasmid 68284 SepOTSγ...phosphopeptides in bacteria for proteome-wide identification of phosphorylation-dependent interactions. ...Rogulina S, Isaacs FJ, and Rinehart J. Nature Communications . 2015. 6, 8130. PubMed Robust Production of...Isaacs FJ, Rinehart J, and Jewett MC. Nature Communications . 2015. 6, 8168. PubMed The PINK1-PARKIN Mitochondrial...

...Insert Promoter PI Publication Drosophila ID Plasmid Gene/Insert Promoter PI Publication Yeast ID Plasmid...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Protocols gRNA Design Tools CRISPR Blog Posts A catalytically inactive Cas9 (dCas9) is fused to FokI nuclease...Plasmid Gene/Insert Promoter PI Publication Do you have suggestions for other plasmids that should be added...

...Genomic Tools for library construction, genomic modification, and cloning systems. Jump to Table: Cloning... or sort by the table headings. Click on the publication link to view all plasmids available from the ...Plasmid Description Gene/Insert Vector Type PI Publication Back to Top Shuttle Vectors Search the table ... or sort by the table headings. Click on the publication link to view all other plasmids from that article...Description Vector Type Selectable Marker PI Publication Back to Top Do you have suggestions for other...

...expressed from plasmids. These antibodies undergo application-specific validation and consistent quality control...and provide experimental data for recommended applications. Addgene values transparency and accessibility...Additionally, we have developed a variety of educational resources to help you choose and use antibodies...antibodies developed and validated for many research applications. Browse Antibodies Production Interested in ... storage techniques, and explain common applications. View Guide Need Some Help? Browse some of our...

...DNA. Fusing the catalytic domain of ADAR2(E488Q) adenosine deaminase to catalytically dead Cas13b creates...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...binding. Editors carrying the delta-984-1090 ADAR2 truncation retain RNA editing capabilities but are small...systems. Mammalian ID Plasmid Gene/Insert PI Publication Do you have suggestions for other plasmids that...

...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...using any of these gRNA plasmids and review the publication associated with each plasmid for more information...upstream of a 5' NGG 3' PAM sequence. Which CRISPR application is this gRNA sequence compatible with? CRISPR...CRISPR nuclease and function. Please see the publication or plasmid information page, or contact the depositing...plasmids. Plasmid Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that...

...tags/fusions for protein expression and/or purification Truncated SARS-CoV-2 Spike gene constructs for making...-terminal tags for protein expression and/or purification Yeast expression: SARS-CoV-2 genes in yeast ...-terminal tags for protein expression and/or purification Mammalian expression: SARS-CoV-2 genes in mammalian...-terminal tags for protein expression and/or purification. Use the search bar or sort buttons to find ...

...Marker PI Publication Bacteria Plasmid Gene/Insert Promoter Selectable Marker PI Publication Plant Plasmid...Marker PI Publication Drosophila Plasmid Gene/Insert Promoter Selectable Marker PI Publication Empty Prime...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...

...MoClo : Modular cloning for applications like recombinant protein purification and cell-free circuit design...distributes cannot be used to reconstitute self-replicating microbes or recreate the diseases they cause....our Search page to look for specific genes or applications that are not listed here. Addgene Microbiology...fluorescent protein plasmid collection is organized by application and by color. External Resources European Saccharomyces...

...Golden Gate TALEN kit. The GoldyTALEN scaffold is truncated at both the N and C terminus and induces mutation...pC-GoldyTALEN directs expression of TALENs from a truncated CAGs promoter. RCIscript-GoldyTALEN is designed...in vitro mRNA synthesis from the T7 promoter. Truncations were introduced to the N- and C-terminus of the...Golden Gate TALEN 2.0 48705 pTAL7a Boris Greber Application of TALEN technology in hPSCs pTAL7a and pTAL7b...expression in mammalian cells, (iv) an improved, truncated TALE backbone architecture as established by Miller...

... expression, transgenics and genome modification Species-Specific Expression If you want to drive...His or optimized YFP tags for purification or localization experiments Yeast...for bacterial expression (Gateway) GST Protein Purification pEBG - N-terminal GST for mammalian... packaging and expression. See our dedicated lentiviral plasmid page . Retroviral Easy and ...shRNA expression, transgenics and genome modification Element Details Representative Empty ...

...computational pipeline that enables accurate quantification and visualization of CRISPR-Cas9 outcomes, ...off-target sites. This algorithm allows for the quantification of both non-homologous end joining (NHEJ) and...number of potential off-targets, target's genomic location, and genome annotation. Available genomes are ...sequence, which can be an accession number, genomic location, pasted nucleotide sequence, or a sequence text...-EGFP PDF 2.3 MB Zhang GeCKO pooled library amplification 1 vector system: lentiCRISPR v2 2 vector system...

... disruptions, missense mutations located in the MBD, and truncations prior to the NID are more severe ...even within patients with the same mutation, the location and type of MECP2 mutation can be a strong predictor...Line Mutation (DNA) Background Strain Purpose Publication PI Mecp2 NLucTom Knock-in of NLuc-tdTomato at...DNA) Mutation (protein) Sex Source of Material Publication PI N126I A377T N126I M Fibroblasts & iPSC (Link...

...defined by their location, their pathway dependencies are extremely important for classification and treatment...network for transitioning between anabolic and catabolic states. Ras Ras is a GTPase that is essential ... described in the initial Target Accelerator publications, focused on somatic variants found in lung adenocarcinoma...

...Selectable Marker PI Publication Bacterial ID Plasmid Gene/Insert PI Publication Plant ID Plasmid Gene...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Gene/Insert PI Publication Do you have suggestions for other plasmids that should be added to this list?...

... the target site sequence (protospacer+PAM) is located? If there are other PAMs in the region, will they...puromycin selection. You could then confirm this purification by performing a genotyping assay (such as Sanger...genomic DNA as template after performing gDNA purification and have tried conditions with 5% DMSO or without...very robust in this case for EMX1. Since the publication of our paper, we have two new optimized primers...can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Why does...