Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 79 results for: promoter

Showing: 21 - 40 of 79 results

  1. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...Insert Promoter Selectable Marker PI Publication Return to top Plant ID Plasmid Gene/Insert Promoter Selectable...CRISPR Guide . Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top...top Bacteria ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top Drosophila ...find a gRNA vector based on expression system, promoter, the type of gRNA (e.g., pegRNA, epegRNA, nicking...plasmid contains Cas9. ID Plasmid Expression System Promoter Guide RNA Type Cloning Enzyme Co-expressed Cas9...

  2. Recombinases AAV Preps

    Type
    Collection
    ...information about these molecular tools. Cre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40...AAV.TBG.PI.Cre.rBGe TBG none 8 James M. Wilson Dre AAV ID Name Promoter Fluorophore Serotype(s) PI 50363 AAV phSyn1(S)... Syn none 5, rg* Hongkui Zeng Flpo AAV ID Name Promoter Fluorophore Serotype(s) PI 51669 AAV phSyn1(S)...Deisseroth Light-Inducible Recombinases ID Name Promoter Fluorophore Serotype(s) PI 140135 pAAV-EF1a-iCreV...EF1a none 1, PHPeB Hongkui Zeng VCre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 55638 pAAV-EF1a-vCre...

  3. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...specific times or locations using cell-specific promoters or inducible systems, you can precisely control...fragments and placed under the control of different promoters. Expression of both fragments in the same cell... lox-STOP-lox shRNA constructs, Cre expression promotes shRNA expression. Gene Switch: These constructs...plasmids based on your expression system of choice, promoter, or search by inducible system (e.g., search for...Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources Explore our full...Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources Search our full...

  4. CRISPR Plasmids - C. elegans

    Type
    Collection
    ...lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select...variety of Cas-containing plasmids. ID gRNA Plasmid Promoter Cloning Enzyme(s) Delivery Resistance Co-expressed...

  5. CRISPR Plasmids - dCas9-FokI

    Type
    Collection
    ...Plasmid Gene/Insert Promoter PI Publication Drosophila ID Plasmid Gene/Insert Promoter PI Publication Yeast...Yeast ID Plasmid Gene/Insert Promoter PI Publication Do you have suggestions for other plasmids that should...

  6. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ...Insert Promoter Selectable Marker PI Publication Return to top Plant ID Plasmid Gene/Insert Promoter Selectable...modification is typically targeted to a specific promoter or enhancer for your gene of interest. These modifications...

  7. CRISPR Plasmids - Purify Genomic Loci

    Type
    Collection
    ...Insert Promoter Selectable Marker PI Publication Return to top Yeast ID Plasmid Gene/Insert Promoter Selectable...CRISPR Guide . Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top...

  8. Validated gRNA Sequences

    Type
    Collection
    ...CYC1m promoter S. cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu CYC1m promoter S.... or repression experiments use targets within promoters. When possible, the categories described on Addgene's... 46917 interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes...pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949...23977949 Lu CYC1m promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes 23977949 Lu CYC1m...GTTGAAAGTATTAGTTAAAG 64388 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate...

  9. Caltech Systemic Capsids

    Type
    Collection
    ... window) . Browse Available PHP.eB AAV ID Name Promoter Description Category PI Controls 28306 pAAV-FLEX-tdTomato... #103006) . Browse Available PHP.S AAV ID Name Promoter Description Category PI 28306 pAAV-FLEX-tdTomato...#127847) . Browse Available PHP.V1 AAV ID Name Promoter Description Category PI 104052 pAAV-CAG-DIO-EYFP...#185136) . Browse Available MaCPNS1 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#185137) . Browse Available MaCPNS2 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175004) . Browse Available CAP-B10 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175005) . Browse Available CAP-B22 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...

  10. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...Gene/Insert Promoter PI Publication Return to top Bacteria ID Plasmid Gene/Insert Promoter PI Publication...Publication Return to top Plant ID Plasmid Gene/Insert Promoter PI Publication Return to top CRISPR Resources ...

  11. mTOR Pathway

    Type
    Collection
    ...anabolic to catabolic processes. Active mTORC1 promotes protein and lipid synthesis, and increases energy... cancer. Loss of the tumor suppressor p53 also promotes aberrant mTORC1 activity, and multiple familial...mTORC1. The hyperactivation of mTORC1 in cancer promotes the conditions needed for uncontrolled cell growth... which appears to signal upstream of Akt, also promotes cell survival and proliferation. mTOR Pathway ...

  12. Lentivirus Plasmids

    Type
    Collection
    ...shRNA under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB 3rd Inducible expression...11795 pLL3.7 3rd Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor...silencing were added; Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor...with a chimeric 5’LTR, Any expression cassette (promoter and gene of interest) can be cloned into the plasmid...coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP...

  13. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...plasmid (Loqué et al., 2007) containing the PMA1 promoter and the URA3 marker, the p415 plasmid (Loqué et... et al., 2007) containing the TEF1 promoter and the LEU2 marker, or the pCEV-G2-Km plasmid (Vickers et...et al., 2013) containing the TEF1 or PGK1 promoters and the KanMX marker. ID Plasmid Gene/Insert Selectable...

  14. Synthetic Biology - Overview

    Type
    Collection
    ... and synthetic regulatory elements, including promoters, terminators, repressors, activators, and more...Featured SynBio Deposits Alper Lab Y. Lipolytica Promoters Anderson Lab Plasmids and Phagemids Balazsi Lab...Ellis Lab GeneGuard Endy Lab Logic Gates , BIOFAB Promoter/BCD Kit , and pOSIP Plasmid Kit Gray Lab Maize...

  15. Synthetic Biology - Networks and Gene Regulation

    Type
    Collection
    ...higher level gene networks. Examples Include: promoters and terminators repressors and activators logic...depositor's lab. Plasmid Gene/Insert Vector Type Promoter PI Publication Back to Top Do you have suggestions...

  16. Depositor Collections

    Type
    Collection
    ...Community (MCC) Collection Pleiades Promoter Project: mini-promoters to drive selective expression in the...

  17. Worm Expression Resources

    Type
    Collection
    ...recombinase from either a heat-shock promoter or a tissue-specific promoter and expression of the target FLP-out... from either a ubiquitous or a tissue-specific promoter. cGAL and Split cGAL plasmids - Paul Sternberg...

  18. CRISPR Plasmids - Xenopus

    Type
    Collection
    ...specific genomic changes. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select...variety of Cas-containing plasmids. ID gRNA Plasmid Promoter Cloning Enzyme(s) Delivery Resistance Co-expressed...

  19. CRISPR Plasmids - Zebrafish

    Type
    Collection
    ... than NHEJ. ID Plasmid Gene/Insert Vector Type Promoter PI Publication Empty gRNA Expression Vectors Select...variety of Cas-containing plasmids. ID gRNA Plasmid Promoter Cloning Enzyme(s) Delivery Resistance Co-expressed...

  20. Brain Armamentarium

    Type
    Collection
    ...Viviana Gradinaru 163489-AAV1 AiP1051-pAAV-Synapsin promoter-oNigri-WPRE-hGHpA Direct-expressing oNigri AAV...pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana Gradinaru 37825-CAP-B22 ...pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana Gradinaru 37825-CAP-MaCPNS1...pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana Gradinaru 37825-CAP-MaCPNS2...pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana Gradinaru...
Showing: 21 - 40 of 79 results