Skip to main content
Addgene
Showing: 21 - 40 of 92 results

  1. TALEN Plasmids and Kits

    Type
    Collection
    ...DNA sequences within core promoter regions. pTAL5-BB contains the GAL1 promoter, placing TALORs built into...the strong CAG promoter or can be achieved by in vitro mRNA synthesis from the T7 promoter. Truncations ...directs expression of TALENs from a truncated CAGs promoter. RCIscript-GoldyTALEN is designed for in vitro...galactose-inducible expression. pTAL6-BB contains the TEF1 promoter, giving constitutive expression of TALORs built...for blue/white-screening in E.coli , (iii) CAG promoter and Kozak sequence to drive efficient TALEN expression...double-transfected mammalian cells. In addition, a T7 promoter was included for generating TALEN mRNAs through...expression. The vectors listed below have the EF1α promoter for efficient mammalian cell expression, and encode...

  2. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Nick CRISPR/Cas nickase mutants...-directed repair (HDR). ID Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused...edits on an RT template. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select...variety of Cas-containing plasmids. ID gRNA Plasmid Promoter Cloning Enzyme(s) Delivery Resistance Co-expressed...

  3. CRISPR Plasmids - Plants

    Type
    Collection
    ...opposite strand) mutations. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas...-directed repair (HDR). ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Prime Edit Cas9...edits on an RT template. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Interfere Catalytically...Design your gRNA to target your gene of interest’s promoter/enhancer or the beginning of the coding sequence...to your specific locus. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Empty gRNA Expression...

  4. The Pleiades Promoter Project

    Type
    Collection
    ...Collections Pleiades Promoter Plasmids Pleiades Promoter Project The Pleiades Promoter Project was established...Positive Control CAG promoter pEMS1293 cre CAG promoter pEMS1164 EGFP/cre CAG promoter pEMS1114 EGFP/cre/...cre/NLS CAG promoter pEMS1157 EGFP/NLS CAG promoter pEMS1277 EGFP/NLS CAG promoter pEMS1294 intron-lacZ/...Plasmids from the Pleiades Promoter Project - A regulatory toolbox of MiniPromoters to drive selective expression...mouse brain through these human MiniPromoters. Browse the Pleiades Promoter Plasmids using the table below...intron-lacZ/NLS CAG promoter pEMS1488 intron-lacZ/NLS Ple2 ADORA2A pEMS1142 EGFP/NLS Ple3 ADORA2A pEMS1143 EGFP/...Open Access Article . List of Pleiades MiniPromoters MiniPromoter Source Gene Construct Reporter Negative...

  5. CRISPR Plasmids - Base Edit

    Type
    Collection
    ...Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable...Gene/Insert Promoter Selectable Marker PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable ...PI Publication Zebrafish ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions...

  6. Jaenisch Lab CRISPR Plasmids

    Type
    Collection
    ...provides the specificity and is designed to target promoters or enhancers of genes of interest. Different flavors...expressing both dCas9VP48 and sgRNA from separate promoters. 48238 pAC152-dual-dCas9VP64-sgExpression : Dual...expressing both dCas9VP64 and sgRNA from separate promoters. 48239 pAC153-dual-dCas9VP96-sgExpression : Dual...expressing both dCas9VP64 and sgRNA from separate promoters. 48240 pAC154-dual-dCas9VP160-sgExpression : Dual...expressing both dCas9VP64 and sgRNA from separate promoters. Table 2. pmax dCas9 Activator Expression Plasmids...

  7. Kamoun Lab CRISPR Plasmids

    Type
    Collection
    ... 35S promoter in the plant tissue. 46968 pICSL01009::AtU6p : Encodes the Arabidopsis U6 promoter in a ...used to place an sgRNA uder the Arabidopsis U6 promoter. 46966 pICH86966::AtU6p::sgRNA_PDS : Expresses... Nicotiana benthamiana from the Arabidopsis U6 promoter. 48075 pICH86966 : A binary vector for plant gene...

  8. Fujii Lab CRISPR Plasmids

    Type
    Collection
    ...Expresses a guide RNA (gRNA) to target human IRF-1 promoter 61080 gRNA-hIRF-1 #12/pSIR Expresses a guide RNA... RNA (gRNA) to target human IRF-1 promoter 62190 3xFLAG-dCas9/pTEF1p-CYC1t Expresses 3xFLAG-dCas9 in budding...expressing dCas9-2xAM and gRNA for human IRF-1 promoter. 98041 Sa-dCas9-NLS-3xFLAG/pcDNA3.1 Expresses ...Expresses a guide RNA (gRNA) to target human IRF-1 promoter for the Sa-Cas9 system. 105283 hIRF-1 gRNA #351...Expresses a guide RNA (gRNA) to target human IRF-1 promoter for the Sa-Cas9 system. References An enChIP system...:387. doi: 10.1186/s13104-018-3486-3. PubMed . Promoter-associated proteins of EPAS1 identified by enChIP-MS...regions that physically interact with the Pax5 promoter in a chicken B cell line. Fujita T, Kitaura F,...

  9. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable...Gene/Insert Promoter Selectable Marker PI Publication Drosophila ID Plasmid Gene/Insert Promoter Selectable...find a gRNA vector based on expression system, promoter, the type of gRNA (e.g., pegRNA, epegRNA, nicking...plasmid contains Cas9. Plasmid Expression System Promoter Guide RNA Type Cloning Enzyme Co-expressed Cas9...

  10. Recombinases AAV Preps

    Type
    Collection
    ...used to control gene expression. Dre AAV ID Name Promoter Fluorophore Serotype(s) PI 50363 AAV phSyn1(S)...DreO-bGHpA Syn none 5, rg* Zeng Flpo AAV ID Name Promoter Fluorophore Serotype(s) PI 51669 AAV phSyn1(S)...-FlpO CAG none 1, rg* Janelia VCre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 55638 pAAV-EF1a-vCre...pAAV-EF1a-vCre EF1a none 8, rg* Deisseroth Cre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40... 8 Wilson Light-Inducible Recombinases ID Name Promoter Fluorophore Serotype(s) PI 140135 pAAV-EF1a-iCreV...

  11. FlyCRISPR

    Type
    Collection
    ... allows in vitro production of RNA from the T7 promoter, while pMB70 is designed for in vivo transcrition...nuclease under the control of the Drosophila hsp70 promoter. 45945 pHsp70-Cas9 : The codon-optimized Cas9 ...nuclease under the control of the Drosophila hsp70 promoter used in Gratz, et al. (2013). Plasmid is low copy...under the control of the Drosophila snRNA:U6:96Ab promoter. 51019 pDsRed-attP : Vector for generating dsDNA...

  12. CRISPR Plasmids - dCas9-FokI

    Type
    Collection
    ...Plasmid Gene/Insert Promoter PI Publication Drosophila ID Plasmid Gene/Insert Promoter PI Publication Yeast...Yeast ID Plasmid Gene/Insert Promoter PI Publication Do you have suggestions for other plasmids that should...

  13. CRISPR Plasmids - C. elegans

    Type
    Collection
    ...lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select...variety of Cas-containing plasmids. gRNA Plasmid Promoter Cloning Enzyme(s) Delivery Resistance Co-expressed...

  14. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ...Gene/Insert Promoter Selectable Marker PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable ...modifiers. Design your gRNA to target a specific promoter or enhancer for your gene of interest. Available...

  15. Synthetic Biology - Overview

    Type
    Collection
    ... and synthetic regulatory elements, including promoters, terminators, repressors, activators, and more...Featured SynBio Deposits Alper Lab Y. Lipolytica Promoters Anderson Lab Plasmids and Phagemids Balazsi Lab...Ellis Lab GeneGuard Endy Lab Logic Gates , BIOFAB Promoter/BCD Kit , and pOSIP Plasmid Kit Gray Lab Maize...community-created BioBricks BioBricks Foundation - Promoting open and ethical synthetic biology JBEI - Joint...

  16. Cre-lox system

    Type
    Collection
    ...system is tight temporal regulation. Promoter-regulated Cre: The promoter region defines the areas in which...active promoter like CAG, or expressed only in a subset of cells under a more specific promoter (e.g. ... PBAD promoter Bacterial Richmond 112614 pVHC Venus and Cre-ERT2 with MCS for inserting promoter none ...inserting promoter none Mammalian Heller 112616 pmTHC TFP and Cre-ERT2 with MCS for inserting promoter none...respectively) and placed under the control of different promoters. Expression of both N and CCre in the same cell...your experiment. You can search the table for the promoter, fusion, or expression system of choice. We also...currently in our repository. ID Plasmid Description Promoter Expression System PI 8394 p209 pCMV-cre-K Cre-...

  17. CRISPR Plasmids - Purify Genomic Loci

    Type
    Collection
    ...Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable...Marker PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions...

  18. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...Plasmid Gene/Insert Promoter PI Publication Bacteria ID Plasmid Gene/Insert Promoter PI Publication Plant...Plant ID Plasmid Gene/Insert Promoter PI Publication Last reviewed on: January 30, 2025 Do you have suggestions...

  19. Caltech Systemic Capsids

    Type
    Collection
    ... window) . Browse Available PHP.eB AAV ID Name Promoter Description Category PI Controls 28306 pAAV-FLEX-tdTomato... #103006) . Browse Available PHP.S AAV ID Name Promoter Description Category PI 28306 pAAV-FLEX-tdTomato...#127847) . Browse Available PHP.V1 AAV ID Name Promoter Description Category PI 104052 pAAV-CAG-DIO-EYFP...#185136) . Browse Available MaCPNS1 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#185137) . Browse Available MaCPNS2 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175004) . Browse Available CAP-B10 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175005) . Browse Available CAP-B22 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...

  20. Validated gRNA Sequences

    Type
    Collection
    ...CYC1m promoter S. cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu CYC1m promoter S.... or repression experiments use targets within promoters. When possible, the categories described on Addgene's... 46917 interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes...pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949...23977949 Lu CYC1m promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes 23977949 Lu CYC1m...GTTGAAAGTATTAGTTAAAG 64388 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate...
Showing: 21 - 40 of 92 results