...this list? Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve this resource...to genetics, high-throughput screening and non-invasive live imaging. A standard toolbox of genetic methods...

...factors. For example, variations of Apolipoprotein E (APOE), such as the ε4 allele, are a risk factor for...symptoms through medication and surgery. PD primarily involves the malfunction and death of dopamine-producing...other large scale studies. Researchers are now investigating the role that these additional genes may play...

...propagated in the endA -mutated NEB Stable strain of E. coli . In addition, plasmids are typically prepared...correct integrated provirus using PCR. This assay involves transducing cells with serial dilutions of the...

...article 60224 cut S. pyogenes 25263330 Zhang LacZ E. coli TGCGAATACGCCCACGCGAT 60225 cut S. pyogenes 25263330...ACTCCAGTCTTTCTAGAAGA 64216 cut S. pyogenes 25803306 Kuhn rpsL E. coli AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. ... Sato inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A....26018130 Xue inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A...

...nuclease are human codon optimized but function well in E. coli . Bacteria expressing NM and TD may grow slightly...with custom guide RNA (gRNA) in human cells: this involves co- expression of a Cas9 protein bearing a C terminus...

...screening in human cells. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelsen TS, Heckl D, Ebert BL,...) is a microbial nuclease system involved in defense against invading phages and plasmids. CRISPR loci...increase targeting efficiency. These plasmids use the inverted terminal repeats (ITR) from AAV serotype 2. SaCas9...

...Osmolarity SED1 osmolarity biosensor, for expression in E. coli , yeast, or plants Intrinsically disordered ...this list? Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve this resource... experimental design, biosensors can enable investigation of a signaling pathway or measurement of a biomolecule...2011;6(12):e28245. Uwe Sauer Citrate Direct or inverse fluorescent biosensor for citrate (Citron/Citroff...cytosolic High-Performance Intensiometric Direct- and Inverse-Response Genetically Encoded Biosensors for Citrate...

...Anti-MBP [N128A/4R] Maltose binding protein (MBP) E. coli Mouse IgG2a 206532 Anti-Keyhole limpet hemocyanin...IgG2a 206546 Anti-Thioredoxin [N245/44R] Thioredoxin E. coli Mouse IgG2a 206547 Anti-DNAH7 [N250/21R] DNAH7...separate elements of the R-mAb expression plasmid involved in coexpression of light (green) and heavy (blue...

...this list? Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve this resource...several sources (Chan Zuckerberg Initiative, MedGen, ClinVar) and is meant to be representative but not exhaustive...