Skip to main content
Addgene
Showing: 1 - 20 of 65 results
  1. Validated gRNA Sequences

    Type
    Collection
    ...41817 cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes...ade6-L469 S. pombe TCTATTGTTCAGATGCCTTG 52227 cut S. pyogenes 25352017 Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG... 52226 cut S. pyogenes 25352017 Zaratiegui ade6+ S. pombe TCTATTGTTCAGATGCCTCG 52225 cut S. pyogenes 25352017...70655 cut S. pyogenes 26472758 Sabatini CAN1 S. cerevisiae GATACGTTCTCTATGGAGGA 43803 cut S. pyogenes ...interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate S. pyogenes...promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes...
  2. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...none S. pyogenes Gao pZmU3-gRNA 53061 Plant none S. pyogenes Gao pU6-gRNA 53062 Plant BbsI none S. pyogenes...vector was designed to be used with, such as S. pyogenes, S. aureus, N. meningitidis, etc. gRNA scaffolds...Bacteria BsaI none S. pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol...HindIII none S. pyogenes Qi pDD162 (Peft-3::Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein.... elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes Virmilion...BspQI yes, cut S. pyogenes Puro Liu pCFD4-U6:1_U6:3tandemgRNAs 49411 Drosophila BbsI none S. pyogenes Virmilion...Mammalian AfIII none S. pyogenes Bleocin Church MLM3636 43860 Mammalian BsmBI none S. pyogenes Joung pSPgRNA...
  3. CRISPR Plasmids - Plants

    Type
    Collection
    ...none S. pyogenes Chen pCBC-MT3T4 see paper BsaI none S. pyogenes Chen pBUN421 TaU3 BsaI yes, cut S. pyogenes...AarI none S. pyogenes Gao pZmU3-gRNA maize U3 none S. pyogenes Gao pU6-gRNA wheat U6 BbsI none S. pyogenes...BbsI none S. pyogenes Stupar pBUE411 OsU3 yes, cut S. pyogenes Basta Chen pHUE411 OsU3 yes, cut S. pyogenes...pICSL01009::AtU6p aU6 BsaI none S. pyogenes Kamoun pUC119-gRNA U6 PCR template none S. pyogenes Sheen pRGEB31 ...rice snoRNA U3 BsaI none S. pyogenes Yang pBUN6A11 OsU3 BsaI yes, activate S. pyogenes Bar Chen pBUN6I11...OsU3 BsaI yes, interfere S. pyogenes Bar Chen pBUN501 AtU6-26 BsaI yes, nick S. pyogenes Bar Chen pCBC-...Chen pHAtC U6 AarI yes, cut S. pyogenes Hygro Kim pBAtC U6 AarI yes, cut S. pyogenes Basta Kim pHEE401...
  4. Gersbach Lab CRISPR Plasmids

    Type
    Collection
    ...Expresses the S. pyogenes sgRNA from the H1 promoter. 53187 pmU6-gRNA : Expresses the S. pyogenes sgRNA...Expresses the S. pyogenes sgRNA from the human U6 promoter. 53189 ph7SK-gRNA : Expresses the S. pyogenes ...optimized S. pyogenes Cas9 and GFP. 53191 pLV hUbC-dCas9-T2A-GFP : Co-expresses human optimized S. pyogenes...Plasmid 47106 pcDNA-dCas9 : Expresses inactivated S. pyogenes dCas9 (D10A, H840A) in mammalian cells. .... 47107 pcDNA-dCas9-VP64 : Expresses inactivated S. pyogenes dCas9 (D10A, H840A) fused to VP64 transactivator...domain in mammalian cells. 47108 pSPgRNA : Expresses a S. pyogenes Cas9/dCas9 guide RNA in mammalian cells....hUbC-dCas9 VP64-T2A-GFP : Co-expresses human optimized S. pyogenes dCas9-VP64 and GFP...
  5. Recombinases AAV Preps

    Type
    Collection
    ... ID Name Promoter Fluorophore Serotype(s) PI 50363 AAV phSyn1(S)-DreO-bGHpA Syn none 5, rg* Zeng Flpo ... ID Name Promoter Fluorophore Serotype(s) PI 51669 AAV phSyn1(S)-FlpO-bGHpA hSyn none rg* Zeng 55634 pAAV-EF1a-mCherry-IRES-Flpo...VCre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 55638 pAAV-EF1a-vCre EF1a none 8, rg* Deisseroth...Cre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI CaMKII Promoter 105551 pENN.AAV.CamKII.HI.GFP-...Recombinases ID Name Promoter Fluorophore Serotype(s) PI 140135 pAAV-EF1a-iCreV EF1a none 1, PHPeB Zeng...
  6. COVID-19 Resources

    Type
    Collection
    ...key step is the priming of the S protein by host cell proteases. The S protein of SARS-CoV-2 is primed...Libraries SARS-CoV-2 Spike (S) Ectodomain and RBD Libraries - Libraries of Spike (S) Ectodomain and RBD mutants... MERS CoV, depends on binding of the viral spike (S) protein to cellular receptors. The cellular receptor...Libraries - Yeast surface display libraries of Spike (S) Ectodomain and RBD mutants that can be used to identify...TMPRSS2 - a serine protease that primes the SARS-CoV-2 S protein and is involved in virus entry into cells....proteins to a biologically active state. The SARS-CoV-2 S protein contains a potential cleavage site for furin...immunoglobulin superfamily, binds to the SARS-CoV-2 S protein and is involved in virus entry into cells....
  7. CRISPR Guide

    Type
    Collection
    ... Ishiguro S, Gao L, Hirano S, Okazaki S, Noda T, Abudayyeh OO, Gootenberg JS, Mori H, Oura S, Holmes B.... One method uses orthogonal dCas9’s (e.g., S. pyogenes dCas9 and S. aureus dCas9) tagged with different...Chavez A, Scheiman J, Vora S, Pruitt BW, Tuttle M, P R Iyer E, Lin S, Kiani S, Guzman CD, Wiegand DJ, Ter-Ovanesyan...endogenous gene(s) without permanently modifying the genome dCas9-activator (such as dCas9-VP64) gRNA(s) targeting...AHY, Menoret S, Brion A, Lamribet K, Dardillac E, Boix C, Perrouault L, Tesson L, Geny S, De Cian A, Itier...Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. Proc Natl Acad Sci U S A . 112(10):3002-7. PMID: 25713381...Overview Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR) systems, which ...
  8. Church Lab CRISPR Plasmids

    Type
    Collection
    ...M-SPcas Mammalian S. pyogenes Cas9 expression, human optimized 48645 DS-SPcas Bacterial S. pyogenes Cas9 ...CYC1t A human codon-optimized Cas9 for expression in S. cerevisiae (budding yeast) from the TEF1 promoter...CYC1t A human codon-optimized Cas9 for expression in S. cerevisiae (budding yeast) from the GalL promoter...SNR52p-gRNA.CAN1.Y-SUP4t A gRNA expression plasmid for use in S. cerevisiae (budding yeast) from the SNR52 promoter...: ID Plasmid Description 48669 M-ST1cas Mammalian S. thermophilus #1 Cas9 expression, human optimized ..., cloDF13/spectinomycin 48647 DS-ST1cas Bacterial S. thermophilus #1 Cas9 (ST1) + tracrRNA expression,...
  9. p53 Pathway

    Type
    Collection
    ...ageing-associated phenotypes. Tyner SD, Venkatachalam S, Choi J, Jones S, Ghebranious N, Igelmann H, Lu X, Soron G...papillomavirus). These mutations interfere with p53’s ability to activate transcription, and they also have...through oligomerization. In particular, the loss of p53’s pro-apoptotic effects is especially important to tumorigenesis...kinase ATR ATR serine/threonine kinase B99 G-2 and S-phase expressed 1; also known as GTSE1 BAI-1 Brain-specific... human malignancy: a clinical perspective. Surget S, Khoury MP, Bourdon JC. Onco Targets Ther. 2013 Dec...
  10. CRISPR References and Information

    Type
    Collection
    ...that identifies putative target sites for S. pyogenes Cas9, S. thermophilus Cas9, or Cpf from your input...checks for off-target binding and can work for S. pyogenes, S. thermophilus or N. meningitidis Cas9 PAMs....position of the observed mutations. Coding sequence/s may be provided to quantify frameshift and potential...support for bacteria ( E. coli, B. subtilis ), yeast ( S. cerevisiae ), worm ( C. elegans ), fruit fly, zebrafish...and news featured on Addgene's blog Protocols Lab(s) Description Plasmids in protocol Download protocol...gRNA: pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s) PDF 47.5 KB Vosshall and Matthews CRISPR/Cas9 reagent...
  11. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...(monocots and dicots) C. elegans Yeast ( S. cerevisiae and S. pombe ) Zebrafish Xenopus References Barrangou... Acad Sci U S A . 112(10):3002-7. PMID: 25713381 Ma H, Tu LC, Naseri A, Huisman M, Zhang S, Grunwald D...and number/types of Cas proteins. Makarova et al. ’s classification defines 5 types and 16 subtypes based...PAM, improving targeting in AT-rich genomes. Cpf1's small size also makes it suitable for multiplexing...Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero DA, Horvath P. 2007. CRISPR provides acquired...12. PMID: 17379808 Bondy-Denomy J, Garcia B, Strum S, Du M, Rollins MF, Hidalgo-Reyes Y, Wiedenheft B, ...407-410. PMID: 28931002 Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini...
  12. Zhang Lab CRISPR Page

    Type
    Collection
    ... CY, Gootenberg JS, Konermann S, Trevino AE, Scott DA, Inoue A, Matoba S, Zhang Y, Zhang F. Cell . 2013...Mouse CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is a microbial nuclease...implemented in mammalian cells by co-expressing the S. pyogenes Cas9 (SpCas9) nuclease along with the guide...The single vector system uses a smaller Cas9 from S. aureus (SaCas9) that has been human codon-optimized...et al., Nature 2015). The dual vector system uses S. pyogenes Cas9 (SpCas9), using one vector to express...using CRISPR/Cas Systems. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini...Hsu PD, Scott DA, Weinstein JA, Ran FA, Konermann S, Agarwala V, Li Y, Fine EJ, Wu X, Shalem O, Cradick...
  13. Kamoun Lab CRISPR Plasmids

    Type
    Collection
    ...Nekrasov V, Staskawicz B, Weigel D, Jones JD, Kamoun S. Nat Biotechnol . 2013 Aug 8;31(8):691-3. PubMed PMID...CRISPR/Cas system. Belhaj K, Chaparro-Garcia A, Kamoun S, Nekrasov V. Plant Methods . 2013 Oct 11;9(1):39. ...pICH86966 : A binary vector for plant gene expression (S. Marillonnet, described in Weber et al. (PLoS One ...
  14. Boxem Lab CRISPR Plasmids

    Type
    Collection
    ...elegans . Waaijers S, Portegijs V, Kerver J, Lemmens BB, w Tijsterman M, van den Heuvel S, Boxem M. Genetics...gRNA Design Tools CRISPR Blog Posts We adapted the S. pyogenes CRISPR/Cas9 system for use in C. elegans...
  15. Deisseroth INTRSECT Collection

    Type
    Collection
    ...24908100 Chuhma N, Mingote S, Yetnikoff L, Kalmbach A, Ma T, Ztaou S, Sienna AC, Tepler S, Poulin JF, Ansorge...:3450-3461. PMID:31553913 Mingote S, Amsellem A, Kempf A, Rayport S, Chuhma N. 2020. Dopamine-glutamate...Ansorge M, Awatramani R, Kang UJ, Rayport S. 2018. Dopamine neuron glutamate cotransmission evokes a delayed...long-range inhibitory neurons. bioRxiv:554360 Yu K, Ahrens S, Zhang X, Schiff H, Ramakrishnan C, Fenno L, Deisseroth...Ramakrishnan C, Fenno L, Deisseroth K, Herry C, Arber S, Lüthi A. 2016. Midbrain circuits for defensive behaviour...
  16. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ..._pSer_Full_library Strain 68306 C321.ΔA.Δserb.Amp S Plasmid 68292 SepOTSλ Plasmid 68307 SupD Plasmid 34623...biological tolerance. Mohler K, Moen JM, Rogulina S, Rinehart J. Mol Syst Biol 2023 Aug 8;19(8):e10591...interactions. Barber KW, Muir P, Szeligowski RV, Rogulina S, Gerstein M, Sampson JR, Isaacs FJ, Rinehart J. Nat...Pirman NL, Barber KW, Ma NJ, Haimovich AD, Rogulina S, Isaacs FJ, and Rinehart J. Nature Communications ... Synthesis. Oza JP, Aerni HR, Pirman NL, Rogulina S, ter Haar CM, Isaacs FJ, Rinehart J, and Jewett MC...deletion. Heinemann IU, Rovner AJ, Aerni HR, Rogulina S, Cheng L, Olds W, Fischer JT, Söll D, Isaacs FJ, Rinehart...
  17. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...Cloning Enzyme(s) Validated In Resistance Co-expressed Cas9 Depositing lab Cas9 species = S. pyogenes (PAM...BsaI E. coli, S. pneumoniae Kanamycin none, need Cas9 plasmid Marraffini pCas9 BsaI E. coli, S. pneumoniae...
  18. Fujii Lab CRISPR Plasmids

    Type
    Collection
    ...CU, Eriksson P, Veerla S, De Preter K, Speleman F, Fujii H, Påhlman S, Mohlin S. Biochem Biophys Res Commun...line. Fujita T, Kitaura F, Yuno M, Suzuki Y, Sugano S, Fujii H. DNA Res. 2017 Oct 1;24(5):537-548. doi: ...by enChIP-Seq. Fujita T, Yuno M, Suzuki Y, Sugano S, Fujii H. Genes Cells. 2017 Jun;22(6):506-520. doi...
  19. EXtracellular Plasmid RESource (EXPRESs) Consortium

    Type
    Collection
    ...profiling. Martin S, Söllner C, Charoensawan V, Adryan B, Thisse B, Thisse C, Teichmann S and Wright GJ Molecular...Bartholdson SJ, Bei AK, Theron M, Uchikawa M, Mboup S, Ndir O, Kwiatkowski DP, Duraisingh MT, Rayner JC ...
  20. CRISPR Plasmids - Yeast

    Type
    Collection
    ...Cloning Enzyme(s) Validated In Resistance Co-expressed Cas9 Depositing lab Cas9 species = S. pyogenes (PAM...PAM = NGG) pRPR1_gRNA_ handle_RPR1t pRPR1 HindIII S. cerevisiae LEU2 none, need Cas9 plasmid Lu Do you...
Showing: 1 - 20 of 65 results