Skip to main content

We narrowed to 845 results for: cat

Showing: 441 - 460 of 845 results
  1. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    Published
    March 13, 2014, 4:08 p.m.
    ...with the newest CRISPR technologies and their applications can be exhausting. A quick search for "CRISPR... the target site sequence (protospacer+PAM) is located? If there are other PAMs in the region, will they...puromycin selection. You could then confirm this purification by performing a genotyping assay (such as Sanger...genomic DNA as template after performing gDNA purification and have tried conditions with 5% DMSO or without...very robust in this case for EMX1. Since the publication of our paper, we have two new optimized primers...can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16:...
  2. Transferable Skills Guide: Identifying Your Transferable Skills

    Type
    Blog Post
    Published
    Jan. 11, 2018, 3:29 p.m.
    ...my job. The same can be said about teamwork, communication, writing, management, and creativity; I have...have the desired degree, you have mastered the applications they use, you’ve gained experience working with...to solve a problem. When they ask about your communication style, your potential teammates want to be assured...ve had to flex your conflict management and communication skills quite a bit. Grab a piece of paper and...Negotiation Career Planning Resources Cross team communication  External collaborators For further advice ...
  3. MXS Chaining

    Type
    Blog Post
    Published
    Feb. 7, 2017, 3:30 p.m.
    ...develop diverse fluorescent reporters is a useful application of high-throughput cloning. MXS Chaining is one...plasmids for fluorescence imaging or flow cytometry applications in mammalian cells. The modules used in this...transgene expression, or a variety of other clever applications. In one example, modular constructs generated...methods are suited for particular downstream applications. The tradeoffs between various cloning methods...technique to engineer various constructs with applications in flow cytometry approaches in mammalian cell...
  4. What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program

    Type
    Blog Post
    Published
    May 2, 2019, 12:41 p.m.
    ... their organismal systems for scientists and educational programs for K-12 students. You can see why I...parenting strategies and make important ecological indicators since species live in water and on land. Current...which have been used to treat heart disease. Caterpillars that eat milkweed generate cardenolides that... poisonous) for bird predators - birds eat a caterpillar once, vomit, and never do it again. Cichlids ... expensive. They are using a cool fluorescent indicator system to rapidly identify recombinants. Arthropods...
  5. Sonic Hedgehog? Sleeping Beauty? Learn About the Genes Behind Addgene’s Conference Room Names

    Type
    Blog Post
    Published
    April 2, 2019, 1:44 p.m.
    ...Addgene recently moved to our brand new location, with more space to grow and help scientists share resources... resources in new ways. Along with a new location comes the need for new conference room names. The Addgenie...transposon system including those from the original publication, Ivics et al 1997. Spaghetti Squash, a regulator...bunch of cookie monster eyes.”  Check out the publication to see for yourself. We have one plasmid in our...Bodmer, Rolf. "The gene tinman is required for specification of the heart and visceral muscles in Drosophila...
  6. Harnessing TnpB for Genome Editing: A Compact and Versatile Tool for Your Research

    Type
    Blog Post
    Published
    July 29, 2025, 1:15 p.m.
    ...positioned like Cas12a PAM sites. For Cas9, the PAM is located just downstream (3′ end) of the target sequence...-strand breaks like those created by Cas12a. Applications of TnpB One of the major challenges in genome...5: Colony Screening Use Primer 92F (5′-cattacgcaattggacgacaac-3′) and Oligo 2 (specific to your target...viral vectors and for multiplexed gene editing applications. As research into TnpB continues to evolve, ...elaborate protocols are available in our earlier publications (Karmakar et al., 2024; Karmakar et al., 2025...
  7. Hot Plasmids: Fall 2024

    Type
    Blog Post
    Published
    Nov. 21, 2024, 1:30 p.m.
    ...performs well in many different antibody-based applications.  IPI’s recombinant version is a fusion of mouse...with additional cofactors or using significantly truncated forms that limit its functionality. To make biophysical...cellular processes in C. elegans: mScarlet3 for applications needing intense brightness (such as low-expression...luciferase fragment (expressed separately) assemble and catalyze the luminescence reaction (Figure 5). The researchers...under tension. Upon binding, LgBiT and BiT Tag catalyze a luminescent reaction with the substrate furimazine...
  8. Fluorescent Proteins 101: When GFP lets you down

    Type
    Blog Post
    Published
    Aug. 23, 2018, 12:05 p.m.
    ... proteins.Therefore, GFP is not suitable for applications that require anaerobic conditions. In experiments...an additional protein module that can report on location. This approach enables the study of proteins in...fusion with GFP allows for detection of genomic locations (Chen et al., 2013). GFP fluorescence overlaps...case when proteins undergo post-translational modification with fatty acyl chains. For instance, myristoylation...C-terminal consensus sequence (-CaaX). Both modifications are disrupted when GFP is fused to these sequences...
  9. CRISPR 101: Validating Your Genome Edit

    Type
    Blog Post
    Published
    Nov. 3, 2022, 12:15 p.m.
    ...how many copies you are looking for. Secondly, categorize your edit – is it any frameshift mutation? A ...enzyme screening for resistivity to digestion, indicating targeted edits.   Interested in this method...a manageable number of the higher probability locations. If you’re worried about off-target effects, you...Tao Chen, Jos Jonkers, Bas van Steensel. Easy quantification of template-directed CRISPR-Cas9 editing. (...and variant-aware in silico off-target site identification for CRISPR genome editing. (2019) Bioinformatics...
  10. Plasmids 101: Common Lab E. coli Strains

    Type
    Blog Post
    Published
    Nov. 7, 2014, 2:56 p.m.
    ...that carried out the labor-intensive process of replicating your new plasmid: the Escherichia coli bacteria...conjugation. Genes listed on F´ are wild-type unless indicated otherwise fhuA (formerly tonA) ferric hydroxamate...vectors. Used by Addgene for pooled library amplification. F' mcrA Δ(mcrBC-hsdRMS-mrr) recA1 endA1 gyrA96...typically standard; just having the gene listed indicates it is non-functional. If a gene is deleted, it... Most Popular Plasmids 101 Posts: Origin of Replication The Promoter Region – Let's Go! Mammalian Vectors...
  11. Viral Vectors 101: AAV Serotypes and Tissue Tropism

    Type
    Blog Post
    Published
    Jan. 16, 2025, 2:15 p.m.
    ...vessel barriers. It is especially popular for applications targeting liver tissue. In addition, it has ...the blood-brain barrier, making it useful for applications targeting the CNS (Issa et al., 2023). Additionally...treatment, which can pose problems for gene therapy applications. Cross-reactivity of AAV serotypes varies by...enhances astrocyte-directed transduction. Nature Communications, 14(1), 3792. https://doi.org/10.1038/s41467.... A. (2023). Various AAV Serotypes and Their Applications in Gene Therapy: An Overview. Cells, 12(5), ...
  12. Building Global Connections with the International Mentorship Program USA-EUROPE

    Type
    Blog Post
    Published
    Nov. 6, 2015, 3:30 p.m.
    ...Universities from five different geographical locations in Spain were enrolled: the University of Valencia...2014/2015, took place on July 27th, 2015 at a dedicated international mentoring conference held at the... own part, mentors receive immense personal gratification as they witness their student’s progress and...like IMP build bridges and global networks. They catalyze the development of knowledge, experience, resources...Mentoring Foundation for the Advancemnet of Higher Education website Resources at Addgene Read Other Career...
  13. The Developmental Studies Hybridoma Bank: Over 25 Years of Antibody Sharing

    Type
    Blog Post
    Published
    March 10, 2015, 2:25 p.m.
    ...target proteins of interest for labeling, quantification, purification, chromatin immunoprecipitation and more...created the Monoclonal Antibody Research Institute dedicated to: 1) developing new ways of generating antibodies...Freedom: The Expansion of Data Sharing in Research Publications ...
  14. An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency

    Type
    Blog Post
    Published
    Dec. 17, 2020, 1:30 p.m.
    ...Mello lab also reported that modifying the 5’ modification of oligos used to generate linear dsDNA repair...Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. ...Forstemann K (2014) Efficient chromosomal gene modification with CRISPR/cas9 and PCR-based homologous recombination...Watts JK, Sontheimer EJ, Mello CC (2018) 5′ Modifications Improve Potency and Efficacy of DNA Donors for...Colaiácovo MP (2013) Heritable Custom Genomic Modifications inCaenorhabditis elegansvia a CRISPR–Cas9 System...
  15. Finding Your Science Policy Path

    Type
    Blog Post
    Published
    Sept. 22, 2020, 1:15 p.m.
    ... policy implementation, program management, communications, diplomacy and international relations, advocacy...they train and bring researchers to Congress to advocate for increased science funding and other issues...sets for a science policy career is science communication so an outsized way to prepare is to do lots ...Initiative.    Get practical experience in science communication by writing for the Journal of Science Policy...connect you with alumni before and during your application process so you can learn more! Figure ...
  16. Plasmid Preps: Different Purity, Different Quantities, Different Uses

    Type
    Blog Post
    Published
    June 16, 2020, 1:25 p.m.
    ...that have been used during the purification procedure. Good indicators of DNA purity are the absorbance...nm should fall ~1.8 - 2 and give scientists an indication of purity versus protein contaminants. The 260...nm ratios should fall ~2 - 2.2, and provide an indication of purity versus chaotropic agents as guanidine...
  17. Our Most Popular Blog Posts from 2019

    Type
    Blog Post
    Published
    Dec. 31, 2019, 2:26 p.m.
    ...resources can now be found in one place: the Educational Resources page. So let’s get to it. Here’s the...Anti-CRISPR, 2in1 Cloning, Fluorescent Voltage Indicators, and Photoswitchable Proteins by Cary Valley,...protein size and shape, linker sequences, and fusion location, there are many choices to make. 2. Prime Editing...Resources at Addgene Browse the repository Find educational resources at Addgene Search for plasmids at Addgene...
  18. What's New in CRISPR - December 2019

    Type
    Blog Post
    Published
    Dec. 17, 2019, 2:37 p.m.
    ... adenine base editor variants using a protein-truncation strategy with reduced RNA-recognition capabilities...engineered tRNA adenosine deaminase (TadA) to a catalytically impaired Streptococcus pyogenes Cas9. They called... toolkit named ORANGE (Open Resource for the Application of Neuronal Genome Editing) mediates targeted...(A-to-I) RNA editor called REPAIR by fusing catalytically inactivated RNA-targeting Cas13 (dCas13) with...
  19. A new platform for fast functional characterization of potentially cancerous mutations

    Type
    Blog Post
    Published
    May 7, 2019, 12:39 p.m.
    ...Thousands of mutations have been implicated in cancer. Yet, the majority of them remain uncharacterized...Using data from The Cancer Genome Atlas (TCGA), a catalog of genetic mutations responsible for cancer from... of mutations they identified included gene amplifications and fusions, missense mutations, and indels...aberration drivers of pancreatic cancer." Nature communications 7 (2016): 10500. PubMed PMID: 26806015. PubMed...
  20. Using Ultrasound to Image Bacteria in vivo: Acoustic Reporter Genes

    Type
    Blog Post
    Published
    June 19, 2018, 1:38 p.m.
    ...Knowing where bacteria are located within their host is often key to understanding their role in both...reporters are not as well suited for imaging organs located deep in the body, like the gastrointestinal tract...lab recently discovered that gas vesicles also scatter sound waves and therefore produce signals in ultrasound... experiment to demonstrate the most exciting application for ARG’s: in vivo imaging. Specifically, arg1...
Showing: 441 - 460 of 845 results